diff --git a/.vscode/settings.json b/.vscode/settings.json new file mode 100644 index 00000000..93139647 --- /dev/null +++ b/.vscode/settings.json @@ -0,0 +1,13 @@ +{ + "go.formatTool": "gofmt", + "go.formatFlags": [ + "-s" + ], + "[go]": { + "editor.insertSpaces": false, + "editor.formatOnSave": true, + "editor.codeActionsOnSave": { + "source.organizeImports": true + } + } +} \ No newline at end of file diff --git a/README.md b/README.md index 8a959dfa..6dbed5a4 100644 --- a/README.md +++ b/README.md @@ -8,20 +8,28 @@

+GitHub All Releases + + + + +GitHub go.mod Go version + +

+ +

+GitHub + - + - - - - - +

支持 Progressive Web Apps 和 Dark Mode 的题解电子书《LeetCode Cookbook》 Online Reading diff --git a/go.mod b/go.mod new file mode 100644 index 00000000..b0f76088 --- /dev/null +++ b/go.mod @@ -0,0 +1,3 @@ +module LeetCode-Go + +go 1.14 diff --git a/leetcode/0001.Two-Sum/1. Two Sum_test.go b/leetcode/0001.Two-Sum/1. Two Sum_test.go index f3cbedbe..e6378be0 100644 --- a/leetcode/0001.Two-Sum/1. Two Sum_test.go +++ b/leetcode/0001.Two-Sum/1. Two Sum_test.go @@ -26,32 +26,30 @@ type ans1 struct { func Test_Problem1(t *testing.T) { qs := []question1{ - - question1{ + { para1{[]int{3, 2, 4}, 6}, ans1{[]int{1, 2}}, }, - question1{ + { para1{[]int{3, 2, 4}, 5}, ans1{[]int{0, 1}}, }, - question1{ + { para1{[]int{0, 8, 7, 3, 3, 4, 2}, 11}, ans1{[]int{1, 3}}, }, - question1{ + { para1{[]int{0, 1}, 1}, ans1{[]int{0, 1}}, }, - question1{ + { para1{[]int{0, 3}, 5}, ans1{[]int{}}, }, - // 如需多个测试，可以复制上方元素。 } diff --git a/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers_test.go b/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers_test.go index 2660d4dd..d615065b 100644 --- a/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers_test.go +++ b/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers_test.go @@ -29,42 +29,42 @@ func Test_Problem2(t *testing.T) { qs := []question2{ - question2{ + { para2{[]int{}, []int{}}, ans2{[]int{}}, }, - question2{ + { para2{[]int{1}, []int{1}}, ans2{[]int{2}}, }, - question2{ + { para2{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans2{[]int{2, 4, 6, 8}}, }, - question2{ + { para2{[]int{1, 2, 3, 4, 5}, []int{1, 2, 3, 4, 5}}, ans2{[]int{2, 4, 6, 8, 0, 1}}, }, - question2{ + { para2{[]int{1}, []int{9, 9, 9, 9, 9}}, ans2{[]int{0, 0, 0, 0, 0, 1}}, }, - question2{ + { para2{[]int{9, 9, 9, 9, 9}, []int{1}}, ans2{[]int{0, 0, 0, 0, 0, 1}}, }, - question2{ + { para2{[]int{2, 4, 3}, []int{5, 6, 4}}, ans2{[]int{7, 0, 8}}, }, - question2{ + { para2{[]int{1, 8, 3}, []int{7, 1}}, ans2{[]int{8, 9, 3}}, }, diff --git a/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters_test.go b/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters_test.go index 03be5391..5dc9bcd2 100644 --- a/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters_test.go +++ b/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters_test.go @@ -26,22 +26,22 @@ func Test_Problem3(t *testing.T) { qs := []question3{ - question3{ + { para3{"abcabcbb"}, ans3{3}, }, - question3{ + { para3{"bbbbb"}, ans3{1}, }, - question3{ + { para3{"pwwkew"}, ans3{3}, }, - question3{ + { para3{""}, ans3{0}, }, diff --git a/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go b/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go index c24c8e53..14d21d0e 100644 --- a/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go +++ b/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go @@ -27,12 +27,12 @@ func Test_Problem4(t *testing.T) { qs := []question4{ - question4{ + { para4{[]int{1, 3}, []int{2}}, ans4{2.0}, }, - question4{ + { para4{[]int{1, 2}, []int{3, 4}}, ans4{2.5}, }, diff --git a/leetcode/0007.Reverse-Integer/7. Reverse Integer_test.go b/leetcode/0007.Reverse-Integer/7. Reverse Integer_test.go index 8fb8e594..4154fb9e 100644 --- a/leetcode/0007.Reverse-Integer/7. Reverse Integer_test.go +++ b/leetcode/0007.Reverse-Integer/7. Reverse Integer_test.go @@ -26,22 +26,22 @@ func Test_Problem7(t *testing.T) { qs := []question7{ - question7{ + { para7{321}, ans7{123}, }, - question7{ + { para7{-123}, ans7{-321}, }, - question7{ + { para7{120}, ans7{21}, }, - question7{ + { para7{1534236469}, ans7{0}, }, diff --git a/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go b/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go index a9eaff03..57f46540 100644 --- a/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go +++ b/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go @@ -26,37 +26,37 @@ func Test_Problem9(t *testing.T) { qs := []question9{ - question9{ + { para9{121}, ans9{true}, }, - question9{ + { para9{-121}, ans9{false}, }, - question9{ + { para9{10}, ans9{false}, }, - question9{ + { para9{321}, ans9{false}, }, - question9{ + { para9{-123}, ans9{false}, }, - question9{ + { para9{120}, ans9{false}, }, - question9{ + { para9{1534236469}, ans9{false}, }, diff --git a/leetcode/0011.Container-With-Most-Water/11. Container With Most Water_test.go b/leetcode/0011.Container-With-Most-Water/11. Container With Most Water_test.go index f48a305e..b9185a28 100644 --- a/leetcode/0011.Container-With-Most-Water/11. Container With Most Water_test.go +++ b/leetcode/0011.Container-With-Most-Water/11. Container With Most Water_test.go @@ -26,12 +26,12 @@ func Test_Problem11(t *testing.T) { qs := []question11{ - question11{ + { para11{[]int{1, 8, 6, 2, 5, 4, 8, 3, 7}}, ans11{49}, }, - question11{ + { para11{[]int{1, 1}}, ans11{1}, }, diff --git a/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go b/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go index 539e6645..b611319e 100644 --- a/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go +++ b/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go @@ -26,32 +26,32 @@ func Test_Problem13(t *testing.T) { qs := []question13{ - question13{ + { para13{"III"}, ans13{3}, }, - question13{ + { para13{"IV"}, ans13{4}, }, - question13{ + { para13{"IX"}, ans13{9}, }, - question13{ + { para13{"LVIII"}, ans13{58}, }, - question13{ + { para13{"MCMXCIV"}, ans13{1994}, }, - question13{ + { para13{"MCMXICIVI"}, ans13{2014}, }, diff --git a/leetcode/0015.3Sum/15. 3Sum_test.go b/leetcode/0015.3Sum/15. 3Sum_test.go index d4413411..e48b7d14 100644 --- a/leetcode/0015.3Sum/15. 3Sum_test.go +++ b/leetcode/0015.3Sum/15. 3Sum_test.go @@ -26,26 +26,26 @@ func Test_Problem15(t *testing.T) { qs := []question15{ - question15{ + { para15{[]int{0, 0, 0}}, - ans15{[][]int{[]int{0, 0, 0}}}, + ans15{[][]int{{0, 0, 0}}}, }, - question15{ + { para15{[]int{-1, 0, 1, 2, -1, -4}}, - ans15{[][]int{[]int{-1, 0, 1}, []int{-1, -1, 2}}}, + ans15{[][]int{{-1, 0, 1}, {-1, -1, 2}}}, }, - question15{ + { para15{[]int{-4, -2, -2, -2, 0, 1, 2, 2, 2, 3, 3, 4, 4, 6, 6}}, - ans15{[][]int{[]int{-4, -2, 6}, []int{-4, 0, 4}, []int{-4, 1, 3}, []int{-4, 2, 2}, []int{-2, -2, 4}, []int{-2, 0, 2}}}, + ans15{[][]int{{-4, -2, 6}, {-4, 0, 4}, {-4, 1, 3}, {-4, 2, 2}, {-2, -2, 4}, {-2, 0, 2}}}, }, - question15{ + { para15{[]int{5, -7, 3, -3, 5, -10, 4, 8, -3, -8, -3, -3, -1, -8, 6, 4, -4, 7, 2, -5, -2, -7, -3, 7, 2, 4, -6, 5}}, - ans15{[][]int{[]int{-10, 2, 8}, []int{-10, 3, 7}, []int{-10, 4, 6}, []int{-10, 5, 5}, []int{-8, 2, 6}, []int{-8, 3, 5}, []int{-8, 4, 4}, []int{-7, -1, 8}, - []int{-7, 2, 5}, []int{-7, 3, 4}, []int{-6, -2, 8}, []int{-6, -1, 7}, []int{-6, 2, 4}, []int{-5, -3, 8}, []int{-5, -2, 7}, []int{-5, -1, 6}, []int{-5, 2, 3}, - []int{-4, -3, 7}, []int{-4, -2, 6}, []int{-4, -1, 5}, []int{-4, 2, 2}, []int{-3, -3, 6}, []int{-3, -2, 5}, []int{-3, -1, 4}, []int{-2, -1, 3}}}, + ans15{[][]int{{-10, 2, 8}, {-10, 3, 7}, {-10, 4, 6}, {-10, 5, 5}, {-8, 2, 6}, {-8, 3, 5}, {-8, 4, 4}, {-7, -1, 8}, + {-7, 2, 5}, {-7, 3, 4}, {-6, -2, 8}, {-6, -1, 7}, {-6, 2, 4}, {-5, -3, 8}, {-5, -2, 7}, {-5, -1, 6}, {-5, 2, 3}, + {-4, -3, 7}, {-4, -2, 6}, {-4, -1, 5}, {-4, 2, 2}, {-3, -3, 6}, {-3, -2, 5}, {-3, -1, 4}, {-2, -1, 3}}}, }, } diff --git a/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go b/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go index 0db2570e..0fd4d392 100644 --- a/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go +++ b/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go @@ -27,27 +27,27 @@ func Test_Problem16(t *testing.T) { qs := []question16{ - question16{ + { para16{[]int{-1, 0, 1, 1, 55}, 3}, ans16{2}, }, - question16{ + { para16{[]int{0, 0, 0}, 1}, ans16{0}, }, - question16{ + { para16{[]int{-1, 2, 1, -4}, 1}, ans16{2}, }, - question16{ + { para16{[]int{1, 1, -1}, 0}, ans16{1}, }, - question16{ + { para16{[]int{-1, 2, 1, -4}, 1}, ans16{2}, }, diff --git a/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go b/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go index fffeeb44..f384ff46 100644 --- a/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go +++ b/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go @@ -26,7 +26,7 @@ func Test_Problem17(t *testing.T) { qs := []question17{ - question17{ + { para17{"23"}, ans17{[]string{"ad", "ae", "af", "bd", "be", "bf", "cd", "ce", "cf"}}, }, diff --git a/leetcode/0018.4Sum/18. 4Sum_test.go b/leetcode/0018.4Sum/18. 4Sum_test.go index a1de6e8d..bc08f2fb 100644 --- a/leetcode/0018.4Sum/18. 4Sum_test.go +++ b/leetcode/0018.4Sum/18. 4Sum_test.go @@ -27,29 +27,29 @@ func Test_Problem18(t *testing.T) { qs := []question18{ - question18{ + { para18{[]int{1, 1, 1, 1}, 4}, - ans18{[][]int{[]int{1, 1, 1, 1}}}, + ans18{[][]int{{1, 1, 1, 1}}}, }, - question18{ + { para18{[]int{0, 1, 5, 0, 1, 5, 5, -4}, 11}, - ans18{[][]int{[]int{-4, 5, 5, 5}, []int{0, 1, 5, 5}}}, + ans18{[][]int{{-4, 5, 5, 5}, {0, 1, 5, 5}}}, }, - question18{ + { para18{[]int{1, 0, -1, 0, -2, 2}, 0}, - ans18{[][]int{[]int{-1, 0, 0, 1}, []int{-2, -1, 1, 2}, []int{-2, 0, 0, 2}}}, + ans18{[][]int{{-1, 0, 0, 1}, {-2, -1, 1, 2}, {-2, 0, 0, 2}}}, }, - question18{ + { para18{[]int{1, 0, -1, 0, -2, 2, 0, 0, 0, 0}, 0}, - ans18{[][]int{[]int{-1, 0, 0, 1}, []int{-2, -1, 1, 2}, []int{-2, 0, 0, 2}, []int{0, 0, 0, 0}}}, + ans18{[][]int{{-1, 0, 0, 1}, {-2, -1, 1, 2}, {-2, 0, 0, 2}, {0, 0, 0, 0}}}, }, - question18{ + { para18{[]int{1, 0, -1, 0, -2, 2, 0, 0, 0, 0}, 1}, - ans18{[][]int{[]int{-1, 0, 0, 2}, []int{-2, 0, 1, 2}, []int{0, 0, 0, 1}}}, + ans18{[][]int{{-1, 0, 0, 2}, {-2, 0, 1, 2}, {0, 0, 0, 1}}}, }, } diff --git a/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go b/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go index bee4e53d..e7be4810 100644 --- a/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go +++ b/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go @@ -29,26 +29,26 @@ func Test_Problem19(t *testing.T) { qs := []question19{ - question19{ + { para19{[]int{1, 2, 3, 4, 5}, 1}, ans19{[]int{1, 2, 3, 4}}, }, - question19{ + { para19{[]int{1, 2, 3, 4, 5}, 2}, ans19{[]int{1, 2, 3, 5}}, }, - question19{ + { para19{[]int{1, 2, 3, 4, 5}, 3}, ans19{[]int{1, 2, 4, 5}}, }, - question19{ + { para19{[]int{1, 2, 3, 4, 5}, 4}, ans19{[]int{1, 3, 4, 5}}, }, - question19{ + { para19{[]int{1, 2, 3, 4, 5}, 5}, ans19{[]int{2, 3, 4, 5}}, }, diff --git a/leetcode/0020.Valid-Parentheses/20. Valid Parentheses_test.go b/leetcode/0020.Valid-Parentheses/20. Valid Parentheses_test.go index 76ce3146..482e54cb 100644 --- a/leetcode/0020.Valid-Parentheses/20. Valid Parentheses_test.go +++ b/leetcode/0020.Valid-Parentheses/20. Valid Parentheses_test.go @@ -26,35 +26,35 @@ func Test_Problem20(t *testing.T) { qs := []question20{ - question20{ + { para20{"()[]{}"}, ans20{true}, }, - question20{ + { para20{"(]"}, ans20{false}, }, - question20{ + { para20{"({[]})"}, ans20{true}, }, - question20{ + { para20{"(){[({[]})]}"}, ans20{true}, }, - question20{ + { para20{"((([[[{{{"}, ans20{false}, }, - question20{ + { para20{"(())]]"}, ans20{false}, }, - question20{ + { para20{""}, ans20{true}, }, - question20{ + { para20{"["}, ans20{false}, }, diff --git a/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists_test.go b/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists_test.go index 8ca0b481..f79777c0 100644 --- a/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists_test.go +++ b/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists_test.go @@ -29,42 +29,42 @@ func Test_Problem21(t *testing.T) { qs := []question21{ - question21{ + { para21{[]int{}, []int{}}, ans21{[]int{}}, }, - question21{ + { para21{[]int{1}, []int{1}}, ans21{[]int{1, 1}}, }, - question21{ + { para21{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans21{[]int{1, 1, 2, 2, 3, 3, 4, 4}}, }, - question21{ + { para21{[]int{1, 2, 3, 4, 5}, []int{1, 2, 3, 4, 5}}, ans21{[]int{1, 1, 2, 2, 3, 3, 4, 4, 5, 5}}, }, - question21{ + { para21{[]int{1}, []int{9, 9, 9, 9, 9}}, ans21{[]int{1, 9, 9, 9, 9, 9}}, }, - question21{ + { para21{[]int{9, 9, 9, 9, 9}, []int{1}}, ans21{[]int{1, 9, 9, 9, 9, 9}}, }, - question21{ + { para21{[]int{2, 3, 4}, []int{4, 5, 6}}, ans21{[]int{2, 3, 4, 4, 5, 6}}, }, - question21{ + { para21{[]int{1, 3, 8}, []int{1, 7}}, ans21{[]int{1, 1, 3, 7, 8}}, }, diff --git a/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go b/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go index 5e21a3da..7f41625e 100644 --- a/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go +++ b/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go @@ -26,7 +26,7 @@ func Test_Problem22(t *testing.T) { qs := []question22{ - question22{ + { para22{3}, ans22{[]string{ "((()))", diff --git a/leetcode/0023.Merge-k-Sorted-Lists/23. Merge k Sorted Lists_test.go b/leetcode/0023.Merge-k-Sorted-Lists/23. Merge k Sorted Lists_test.go index bb66cad4..30989903 100644 --- a/leetcode/0023.Merge-k-Sorted-Lists/23. Merge k Sorted Lists_test.go +++ b/leetcode/0023.Merge-k-Sorted-Lists/23. Merge k Sorted Lists_test.go @@ -28,63 +28,63 @@ func Test_Problem23(t *testing.T) { qs := []question23{ - question23{ + { para23{[][]int{}}, ans23{[]int{}}, }, - question23{ + { para23{[][]int{ - []int{1}, - []int{1}, + {1}, + {1}, }}, ans23{[]int{1, 1}}, }, - question23{ + { para23{[][]int{ - []int{1, 2, 3, 4}, - []int{1, 2, 3, 4}, + {1, 2, 3, 4}, + {1, 2, 3, 4}, }}, ans23{[]int{1, 1, 2, 2, 3, 3, 4, 4}}, }, - question23{ + { para23{[][]int{ - []int{1, 2, 3, 4, 5}, - []int{1, 2, 3, 4, 5}, + {1, 2, 3, 4, 5}, + {1, 2, 3, 4, 5}, }}, ans23{[]int{1, 1, 2, 2, 3, 3, 4, 4, 5, 5}}, }, - question23{ + { para23{[][]int{ - []int{1}, - []int{9, 9, 9, 9, 9}, + {1}, + {9, 9, 9, 9, 9}, }}, ans23{[]int{1, 9, 9, 9, 9, 9}}, }, - question23{ + { para23{[][]int{ - []int{9, 9, 9, 9, 9}, - []int{1}, + {9, 9, 9, 9, 9}, + {1}, }}, ans23{[]int{1, 9, 9, 9, 9, 9}}, }, - question23{ + { para23{[][]int{ - []int{2, 3, 4}, - []int{4, 5, 6}, + {2, 3, 4}, + {4, 5, 6}, }}, ans23{[]int{2, 3, 4, 4, 5, 6}}, }, - question23{ + { para23{[][]int{ - []int{1, 3, 8}, - []int{1, 7}, + {1, 3, 8}, + {1, 7}, }}, ans23{[]int{1, 1, 3, 7, 8}}, }, diff --git a/leetcode/0024.Swap-Nodes-in-Pairs/24. Swap Nodes in Pairs_test.go b/leetcode/0024.Swap-Nodes-in-Pairs/24. Swap Nodes in Pairs_test.go index 56ff303c..9997800f 100644 --- a/leetcode/0024.Swap-Nodes-in-Pairs/24. Swap Nodes in Pairs_test.go +++ b/leetcode/0024.Swap-Nodes-in-Pairs/24. Swap Nodes in Pairs_test.go @@ -28,22 +28,22 @@ func Test_Problem24(t *testing.T) { qs := []question24{ - question24{ + { para24{[]int{}}, ans24{[]int{}}, }, - question24{ + { para24{[]int{1}}, ans24{[]int{1}}, }, - question24{ + { para24{[]int{1, 2, 3, 4}}, ans24{[]int{2, 1, 4, 3}}, }, - question24{ + { para24{[]int{1, 2, 3, 4, 5}}, ans24{[]int{2, 1, 4, 3, 5}}, }, diff --git a/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group_test.go b/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group_test.go index 34baf936..52221c07 100644 --- a/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group_test.go +++ b/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group_test.go @@ -29,7 +29,7 @@ func Test_Problem25(t *testing.T) { qs := []question25{ - question25{ + { para25{ []int{1, 2, 3, 4, 5}, 3, @@ -37,7 +37,7 @@ func Test_Problem25(t *testing.T) { ans25{[]int{3, 2, 1, 4, 5}}, }, - question25{ + { para25{ []int{1, 2, 3, 4, 5}, 1, diff --git a/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go b/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go index 10ee62e1..74cc3ca0 100644 --- a/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go +++ b/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go @@ -26,22 +26,22 @@ func Test_Problem26(t *testing.T) { qs := []question26{ - question26{ + { para26{[]int{1, 1, 2}}, ans26{2}, }, - question26{ + { para26{[]int{0, 0, 1, 1, 1, 1, 2, 3, 4, 4}}, ans26{5}, }, - question26{ + { para26{[]int{0, 0, 0, 0, 0}}, ans26{1}, }, - question26{ + { para26{[]int{1}}, ans26{1}, }, diff --git a/leetcode/0027.Remove-Element/27. Remove Element_test.go b/leetcode/0027.Remove-Element/27. Remove Element_test.go index fa3a1653..719bf7dc 100644 --- a/leetcode/0027.Remove-Element/27. Remove Element_test.go +++ b/leetcode/0027.Remove-Element/27. Remove Element_test.go @@ -27,32 +27,32 @@ func Test_Problem27(t *testing.T) { qs := []question27{ - question27{ + { para27{[]int{1, 0, 1}, 1}, ans27{1}, }, - question27{ + { para27{[]int{0, 1, 0, 3, 0, 12}, 0}, ans27{3}, }, - question27{ + { para27{[]int{0, 1, 0, 3, 0, 0, 0, 0, 1, 12}, 0}, ans27{4}, }, - question27{ + { para27{[]int{0, 0, 0, 0, 0}, 0}, ans27{0}, }, - question27{ + { para27{[]int{1}, 1}, ans27{0}, }, - question27{ + { para27{[]int{0, 1, 2, 2, 3, 0, 4, 2}, 2}, ans27{5}, }, diff --git a/leetcode/0028.Implement-strStr/28. Implement strStr()_test.go b/leetcode/0028.Implement-strStr/28. Implement strStr()_test.go index e0e928ff..d06f2bf7 100644 --- a/leetcode/0028.Implement-strStr/28. Implement strStr()_test.go +++ b/leetcode/0028.Implement-strStr/28. Implement strStr()_test.go @@ -27,32 +27,32 @@ func Test_Problem28(t *testing.T) { qs := []question28{ - question28{ + { para28{"abab", "ab"}, ans28{0}, }, - question28{ + { para28{"hello", "ll"}, ans28{2}, }, - question28{ + { para28{"", "abc"}, ans28{0}, }, - question28{ + { para28{"abacbabc", "abc"}, ans28{5}, }, - question28{ + { para28{"abacbabc", "abcd"}, ans28{-1}, }, - question28{ + { para28{"abacbabc", ""}, ans28{0}, }, diff --git a/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go b/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go index 670ee6de..9be6c89f 100644 --- a/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go +++ b/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go @@ -27,27 +27,27 @@ func Test_Problem29(t *testing.T) { qs := []question29{ - question29{ + { para29{10, 3}, ans29{3}, }, - question29{ + { para29{7, -3}, ans29{-2}, }, - question29{ + { para29{-1, 1}, ans29{-1}, }, - question29{ + { para29{1, -1}, ans29{-1}, }, - question29{ + { para29{2147483647, 3}, ans29{715827882}, }, diff --git a/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words_test.go b/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words_test.go index 7ee2c50c..c6ed5fc3 100644 --- a/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words_test.go +++ b/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words_test.go @@ -27,57 +27,57 @@ func Test_Problem30(t *testing.T) { qs := []question30{ - question30{ + { para30{"aaaaaaaa", []string{"aa", "aa", "aa"}}, ans30{[]int{0, 1, 2}}, }, - question30{ + { para30{"barfoothefoobarman", []string{"foo", "bar"}}, ans30{[]int{0, 9}}, }, - question30{ + { para30{"wordgoodgoodgoodbestword", []string{"word", "good", "best", "word"}}, ans30{[]int{}}, }, - question30{ + { para30{"goodgoodgoodgoodgood", []string{"good"}}, ans30{[]int{0, 4, 8, 12, 16}}, }, - question30{ + { para30{"barofoothefoolbarman", []string{"foo", "bar"}}, ans30{[]int{}}, }, - question30{ + { para30{"bbarffoothefoobarman", []string{"foo", "bar"}}, ans30{[]int{}}, }, - question30{ + { para30{"ooroodoofoodtoo", []string{"foo", "doo", "roo", "tee", "oo"}}, ans30{[]int{}}, }, - question30{ + { para30{"abc", []string{"a", "b", "c"}}, ans30{[]int{0}}, }, - question30{ + { para30{"a", []string{"b"}}, ans30{[]int{}}, }, - question30{ + { para30{"ab", []string{"ba"}}, ans30{[]int{}}, }, - question30{ + { para30{"n", []string{}}, ans30{[]int{}}, }, diff --git a/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go b/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go index 3fcfbb5a..b31eca3b 100644 --- a/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go +++ b/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go @@ -27,17 +27,17 @@ func Test_Problem33(t *testing.T) { qs := []question33{ - question33{ + { para33{[]int{3, 1}, 1}, ans33{1}, }, - question33{ + { para33{[]int{4, 5, 6, 7, 0, 1, 2}, 0}, ans33{4}, }, - question33{ + { para33{[]int{4, 5, 6, 7, 0, 1, 2}, 3}, ans33{-1}, }, diff --git a/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go b/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go index 52d408aa..c8bd3306 100644 --- a/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go +++ b/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go @@ -27,12 +27,12 @@ func Test_Problem34(t *testing.T) { qs := []question34{ - question34{ + { para34{[]int{5, 7, 7, 8, 8, 10}, 8}, ans34{[]int{3, 4}}, }, - question34{ + { para34{[]int{5, 7, 7, 8, 8, 10}, 6}, ans34{[]int{-1, -1}}, }, diff --git a/leetcode/0035.Search-Insert-Position/35. Search Insert Position_test.go b/leetcode/0035.Search-Insert-Position/35. Search Insert Position_test.go index 6947076c..1b9a30bc 100644 --- a/leetcode/0035.Search-Insert-Position/35. Search Insert Position_test.go +++ b/leetcode/0035.Search-Insert-Position/35. Search Insert Position_test.go @@ -27,22 +27,22 @@ func Test_Problem35(t *testing.T) { qs := []question35{ - question35{ + { para35{[]int{1, 3, 5, 6}, 5}, ans35{2}, }, - question35{ + { para35{[]int{1, 3, 5, 6}, 2}, ans35{1}, }, - question35{ + { para35{[]int{1, 3, 5, 6}, 7}, ans35{4}, }, - question35{ + { para35{[]int{1, 3, 5, 6}, 0}, ans35{0}, }, diff --git a/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go b/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go index 0d4ad83b..0477efaa 100644 --- a/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go +++ b/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go @@ -26,45 +26,45 @@ func Test_Problem36(t *testing.T) { qs := []question36{ - question36{ + { para36{[][]byte{ - []byte{'5', '3', '.', '.', '7', '.', '.', '.', '.'}, - []byte{'6', '.', '.', '1', '9', '5', '.', '.', '.'}, - []byte{'.', '9', '8', '.', '.', '.', '.', '6', '.'}, - []byte{'8', '.', '.', '.', '6', '.', '.', '.', '3'}, - []byte{'4', '.', '.', '8', '.', '3', '.', '.', '1'}, - []byte{'7', '.', '.', '.', '2', '.', '.', '.', '6'}, - []byte{'.', '6', '.', '.', '.', '.', '2', '8', '.'}, - []byte{'.', '.', '.', '4', '1', '9', '.', '.', '5'}, - []byte{'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, + {'5', '3', '.', '.', '7', '.', '.', '.', '.'}, + {'6', '.', '.', '1', '9', '5', '.', '.', '.'}, + {'.', '9', '8', '.', '.', '.', '.', '6', '.'}, + {'8', '.', '.', '.', '6', '.', '.', '.', '3'}, + {'4', '.', '.', '8', '.', '3', '.', '.', '1'}, + {'7', '.', '.', '.', '2', '.', '.', '.', '6'}, + {'.', '6', '.', '.', '.', '.', '2', '8', '.'}, + {'.', '.', '.', '4', '1', '9', '.', '.', '5'}, + {'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, ans36{true}, }, - question36{ + { para36{[][]byte{ - []byte{'8', '3', '.', '.', '7', '.', '.', '.', '.'}, - []byte{'6', '.', '.', '1', '9', '5', '.', '.', '.'}, - []byte{'.', '9', '8', '.', '.', '.', '.', '6', '.'}, - []byte{'8', '.', '.', '.', '6', '.', '.', '.', '3'}, - []byte{'4', '.', '.', '8', '.', '3', '.', '.', '1'}, - []byte{'7', '.', '.', '.', '2', '.', '.', '.', '6'}, - []byte{'.', '6', '.', '.', '.', '.', '2', '8', '.'}, - []byte{'.', '.', '.', '4', '1', '9', '.', '.', '5'}, - []byte{'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, + {'8', '3', '.', '.', '7', '.', '.', '.', '.'}, + {'6', '.', '.', '1', '9', '5', '.', '.', '.'}, + {'.', '9', '8', '.', '.', '.', '.', '6', '.'}, + {'8', '.', '.', '.', '6', '.', '.', '.', '3'}, + {'4', '.', '.', '8', '.', '3', '.', '.', '1'}, + {'7', '.', '.', '.', '2', '.', '.', '.', '6'}, + {'.', '6', '.', '.', '.', '.', '2', '8', '.'}, + {'.', '.', '.', '4', '1', '9', '.', '.', '5'}, + {'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, ans36{false}, }, - question36{ + { para36{[][]byte{ - []byte{'.', '8', '7', '6', '5', '4', '3', '2', '1'}, - []byte{'2', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'3', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'4', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'5', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'6', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'7', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'8', '.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'9', '.', '.', '.', '.', '.', '.', '.', '.'}}}, + {'.', '8', '7', '6', '5', '4', '3', '2', '1'}, + {'2', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'3', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'4', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'5', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'6', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'7', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'8', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'9', '.', '.', '.', '.', '.', '.', '.', '.'}}}, ans36{true}, }, } diff --git a/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go b/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go index b6b71f81..d56bd362 100644 --- a/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go +++ b/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go @@ -26,27 +26,27 @@ func Test_Problem37(t *testing.T) { qs := []question37{ - question37{ + { para37{[][]byte{ - []byte{'5', '3', '.', '.', '7', '.', '.', '.', '.'}, - []byte{'6', '.', '.', '1', '9', '5', '.', '.', '.'}, - []byte{'.', '9', '8', '.', '.', '.', '.', '6', '.'}, - []byte{'8', '.', '.', '.', '6', '.', '.', '.', '3'}, - []byte{'4', '.', '.', '8', '.', '3', '.', '.', '1'}, - []byte{'7', '.', '.', '.', '2', '.', '.', '.', '6'}, - []byte{'.', '6', '.', '.', '.', '.', '2', '8', '.'}, - []byte{'.', '.', '.', '4', '1', '9', '.', '.', '5'}, - []byte{'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, + {'5', '3', '.', '.', '7', '.', '.', '.', '.'}, + {'6', '.', '.', '1', '9', '5', '.', '.', '.'}, + {'.', '9', '8', '.', '.', '.', '.', '6', '.'}, + {'8', '.', '.', '.', '6', '.', '.', '.', '3'}, + {'4', '.', '.', '8', '.', '3', '.', '.', '1'}, + {'7', '.', '.', '.', '2', '.', '.', '.', '6'}, + {'.', '6', '.', '.', '.', '.', '2', '8', '.'}, + {'.', '.', '.', '4', '1', '9', '.', '.', '5'}, + {'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, ans37{[][]byte{ - []byte{'5', '3', '4', '6', '7', '8', '9', '1', '2'}, - []byte{'6', '7', '2', '1', '9', '5', '3', '4', '8'}, - []byte{'1', '9', '8', '3', '4', '2', '5', '6', '7'}, - []byte{'8', '5', '9', '7', '6', '1', '4', '2', '3'}, - []byte{'4', '2', '6', '8', '5', '3', '7', '9', '1'}, - []byte{'7', '1', '3', '9', '2', '4', '8', '5', '6'}, - []byte{'9', '6', '1', '5', '3', '7', '2', '8', '4'}, - []byte{'2', '8', '7', '4', '1', '9', '6', '3', '5'}, - []byte{'3', '4', '5', '2', '8', '6', '1', '7', '9'}}}, + {'5', '3', '4', '6', '7', '8', '9', '1', '2'}, + {'6', '7', '2', '1', '9', '5', '3', '4', '8'}, + {'1', '9', '8', '3', '4', '2', '5', '6', '7'}, + {'8', '5', '9', '7', '6', '1', '4', '2', '3'}, + {'4', '2', '6', '8', '5', '3', '7', '9', '1'}, + {'7', '1', '3', '9', '2', '4', '8', '5', '6'}, + {'9', '6', '1', '5', '3', '7', '2', '8', '4'}, + {'2', '8', '7', '4', '1', '9', '6', '3', '5'}, + {'3', '4', '5', '2', '8', '6', '1', '7', '9'}}}, }, } diff --git a/leetcode/0039.Combination-Sum/39. Combination Sum_test.go b/leetcode/0039.Combination-Sum/39. Combination Sum_test.go index b6df4147..8b3a3568 100644 --- a/leetcode/0039.Combination-Sum/39. Combination Sum_test.go +++ b/leetcode/0039.Combination-Sum/39. Combination Sum_test.go @@ -27,14 +27,14 @@ func Test_Problem39(t *testing.T) { qs := []question39{ - question39{ + { para39{[]int{2, 3, 6, 7}, 7}, - ans39{[][]int{[]int{7}, []int{2, 2, 3}}}, + ans39{[][]int{{7}, {2, 2, 3}}}, }, - question39{ + { para39{[]int{2, 3, 5}, 8}, - ans39{[][]int{[]int{2, 2, 2, 2}, []int{2, 3, 3}, []int{3, 5}}}, + ans39{[][]int{{2, 2, 2, 2}, {2, 3, 3}, {3, 5}}}, }, } diff --git a/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go b/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go index ef971623..8c46b3f7 100644 --- a/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go +++ b/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go @@ -27,14 +27,14 @@ func Test_Problem40(t *testing.T) { qs := []question40{ - question40{ + { para40{[]int{10, 1, 2, 7, 6, 1, 5}, 8}, - ans40{[][]int{[]int{1, 7}, []int{1, 2, 5}, []int{2, 6}, []int{1, 1, 6}}}, + ans40{[][]int{{1, 7}, {1, 2, 5}, {2, 6}, {1, 1, 6}}}, }, - question40{ + { para40{[]int{2, 5, 2, 1, 2}, 5}, - ans40{[][]int{[]int{1, 2, 2}, []int{5}}}, + ans40{[][]int{{1, 2, 2}, {5}}}, }, } diff --git a/leetcode/0041.First-Missing-Positive/41. First Missing Positive_test.go b/leetcode/0041.First-Missing-Positive/41. First Missing Positive_test.go index e1d0ba59..0edd5c0d 100644 --- a/leetcode/0041.First-Missing-Positive/41. First Missing Positive_test.go +++ b/leetcode/0041.First-Missing-Positive/41. First Missing Positive_test.go @@ -26,37 +26,37 @@ func Test_Problem41(t *testing.T) { qs := []question41{ - question41{ + { para41{[]int{10, -1, 1, 2, 2, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 5, 5, -3}}, ans41{6}, }, - question41{ + { para41{[]int{10, -1, 8, 6, 7, 3, -2, 5, 4, 2, 1, -3}}, ans41{9}, }, - question41{ + { para41{[]int{1}}, ans41{2}, }, - question41{ + { para41{[]int{0, 2, 2, 1, 1}}, ans41{3}, }, - question41{ + { para41{[]int{}}, ans41{1}, }, - question41{ + { para41{[]int{1, 2, 0}}, ans41{3}, }, - question41{ + { para41{[]int{3, 4, -1, 1}}, ans41{2}, }, diff --git a/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water_test.go b/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water_test.go index a6dc5684..918f5ebb 100644 --- a/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water_test.go +++ b/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water_test.go @@ -26,7 +26,7 @@ func Test_Problem42(t *testing.T) { qs := []question42{ - question42{ + { para42{[]int{0, 1, 0, 2, 1, 0, 1, 3, 2, 1, 2, 1}}, ans42{6}, }, diff --git a/leetcode/0046.Permutations/46. Permutations_test.go b/leetcode/0046.Permutations/46. Permutations_test.go index 74938e15..d90a4e9c 100644 --- a/leetcode/0046.Permutations/46. Permutations_test.go +++ b/leetcode/0046.Permutations/46. Permutations_test.go @@ -26,9 +26,9 @@ func Test_Problem46(t *testing.T) { qs := []question46{ - question46{ + { para46{[]int{1, 2, 3}}, - ans46{[][]int{[]int{1, 2, 3}, []int{1, 3, 2}, []int{2, 1, 3}, []int{2, 3, 1}, []int{3, 1, 2}, []int{3, 2, 1}}}, + ans46{[][]int{{1, 2, 3}, {1, 3, 2}, {2, 1, 3}, {2, 3, 1}, {3, 1, 2}, {3, 2, 1}}}, }, } diff --git a/leetcode/0047.Permutations-II/47. Permutations II_test.go b/leetcode/0047.Permutations-II/47. Permutations II_test.go index 23393075..f997b9a9 100644 --- a/leetcode/0047.Permutations-II/47. Permutations II_test.go +++ b/leetcode/0047.Permutations-II/47. Permutations II_test.go @@ -26,19 +26,19 @@ func Test_Problem47(t *testing.T) { qs := []question47{ - question47{ + { para47{[]int{1, 1, 2}}, - ans47{[][]int{[]int{1, 1, 2}, []int{1, 2, 1}, []int{2, 1, 1}}}, + ans47{[][]int{{1, 1, 2}, {1, 2, 1}, {2, 1, 1}}}, }, - question47{ + { para47{[]int{1, 2, 2}}, - ans47{[][]int{[]int{1, 2, 2}, []int{2, 2, 1}, []int{2, 1, 2}}}, + ans47{[][]int{{1, 2, 2}, {2, 2, 1}, {2, 1, 2}}}, }, - question47{ + { para47{[]int{2, 2, 2}}, - ans47{[][]int{[]int{2, 2, 2}}}, + ans47{[][]int{{2, 2, 2}}}, }, } diff --git a/leetcode/0048.Rotate-Image/48. Rotate Image_test.go b/leetcode/0048.Rotate-Image/48. Rotate Image_test.go index 2f5278ae..76f8f704 100644 --- a/leetcode/0048.Rotate-Image/48. Rotate Image_test.go +++ b/leetcode/0048.Rotate-Image/48. Rotate Image_test.go @@ -26,14 +26,14 @@ func Test_Problem48(t *testing.T) { qs := []question48{ - question48{ - para48{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}, []int{7, 8, 9}}}, - ans48{[][]int{[]int{7, 4, 1}, []int{8, 5, 2}, []int{9, 6, 3}}}, + { + para48{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}}, + ans48{[][]int{{7, 4, 1}, {8, 5, 2}, {9, 6, 3}}}, }, - question48{ - para48{[][]int{[]int{5, 1, 9, 11}, []int{2, 4, 8, 10}, []int{13, 3, 6, 7}, []int{15, 14, 12, 16}}}, - ans48{[][]int{[]int{15, 13, 2, 5}, []int{14, 3, 4, 1}, []int{12, 6, 8, 9}, []int{16, 7, 10, 11}}}, + { + para48{[][]int{{5, 1, 9, 11}, {2, 4, 8, 10}, {13, 3, 6, 7}, {15, 14, 12, 16}}}, + ans48{[][]int{{15, 13, 2, 5}, {14, 3, 4, 1}, {12, 6, 8, 9}, {16, 7, 10, 11}}}, }, } diff --git a/leetcode/0049.Group-Anagrams/49. Group Anagrams_test.go b/leetcode/0049.Group-Anagrams/49. Group Anagrams_test.go index f7c537cc..bee3e303 100644 --- a/leetcode/0049.Group-Anagrams/49. Group Anagrams_test.go +++ b/leetcode/0049.Group-Anagrams/49. Group Anagrams_test.go @@ -26,9 +26,9 @@ func Test_Problem49(t *testing.T) { qs := []question49{ - question49{ + { para49{[]string{"eat", "tea", "tan", "ate", "nat", "bat"}}, - ans49{[][]string{[]string{"ate", "eat", "tea"}, []string{"nat", "tan"}, []string{"bat"}}}, + ans49{[][]string{{"ate", "eat", "tea"}, {"nat", "tan"}, {"bat"}}}, }, } diff --git a/leetcode/0050.Powx-n/50. Pow(x, n)_test.go b/leetcode/0050.Powx-n/50. Pow(x, n)_test.go index b542b446..2558a1b6 100644 --- a/leetcode/0050.Powx-n/50. Pow(x, n)_test.go +++ b/leetcode/0050.Powx-n/50. Pow(x, n)_test.go @@ -27,17 +27,17 @@ func Test_Problem50(t *testing.T) { qs := []question50{ - question50{ + { para50{2.00000, 10}, ans50{1024.00000}, }, - question50{ + { para50{2.10000, 3}, ans50{9.26100}, }, - question50{ + { para50{2.00000, -2}, ans50{0.25000}, }, diff --git a/leetcode/0051.N-Queens/51. N-Queens_test.go b/leetcode/0051.N-Queens/51. N-Queens_test.go index ad665328..2f6cfd17 100644 --- a/leetcode/0051.N-Queens/51. N-Queens_test.go +++ b/leetcode/0051.N-Queens/51. N-Queens_test.go @@ -26,14 +26,14 @@ func Test_Problem51(t *testing.T) { qs := []question51{ - question51{ + { para51{4}, ans51{[][]string{ - []string{".Q..", + {".Q..", "...Q", "Q...", "..Q."}, - []string{"..Q.", + {"..Q.", "Q...", "...Q", ".Q.."}, diff --git a/leetcode/0052.N-Queens-II/52. N-Queens II_test.go b/leetcode/0052.N-Queens-II/52. N-Queens II_test.go index 672af899..a906c2a6 100644 --- a/leetcode/0052.N-Queens-II/52. N-Queens II_test.go +++ b/leetcode/0052.N-Queens-II/52. N-Queens II_test.go @@ -26,51 +26,51 @@ func Test_Problem52(t *testing.T) { qs := []question52{ - question52{ + { para52{1}, ans52{1}, }, - question52{ + { para52{2}, ans52{0}, }, - question52{ + { para52{3}, ans52{0}, }, - question52{ + { para52{4}, ans52{2}, }, - question52{ + { para52{5}, ans52{10}, }, - question52{ + { para52{6}, ans52{4}, }, - question52{ + { para52{7}, ans52{40}, }, - question52{ + { para52{8}, ans52{92}, }, - question52{ + { para52{9}, ans52{352}, }, - question52{ + { para52{10}, ans52{724}, }, diff --git a/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go b/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go index 04e07b05..0a99d22f 100644 --- a/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go +++ b/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go @@ -26,21 +26,21 @@ func Test_Problem53(t *testing.T) { qs := []question53{ - question53{ + { para53{[]int{-2, 1, -3, 4, -1, 2, 1, -5, 4}}, ans53{6}, }, - question53{ + { para53{[]int{2, 7, 9, 3, 1}}, ans53{22}, }, - question53{ + { para53{[]int{2}}, ans53{2}, }, - question53{ + { para53{[]int{-1, -2}}, ans53{-1}, }, diff --git a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go index ae2ae116..93bb3564 100644 --- a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go +++ b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go @@ -19,10 +19,10 @@ func spiralOrder(matrix [][]int) []int { return res } visit, m, n, round, x, y, spDir := make([][]int, len(matrix)), len(matrix), len(matrix[0]), 0, 0, 0, [][]int{ - []int{0, 1}, // 朝右 - []int{1, 0}, // 朝下 - []int{0, -1}, // 朝左 - []int{-1, 0}, // 朝上 + {0, 1}, // 朝右 + {1, 0}, // 朝下 + {0, -1}, // 朝左 + {-1, 0}, // 朝上 } for i := 0; i < m; i++ { visit[i] = make([]int, n) diff --git a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go index e7af57f1..39e0d2ec 100644 --- a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go +++ b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go @@ -26,27 +26,27 @@ func Test_Problem54(t *testing.T) { qs := []question54{ - question54{ - para54{[][]int{[]int{3}, []int{2}}}, + { + para54{[][]int{{3}, {2}}}, ans54{[]int{3, 2}}, }, - question54{ - para54{[][]int{[]int{2, 3}}}, + { + para54{[][]int{{2, 3}}}, ans54{[]int{2, 3}}, }, - question54{ - para54{[][]int{[]int{1}}}, + { + para54{[][]int{{1}}}, ans54{[]int{1}}, }, - question54{ - para54{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}, []int{7, 8, 9}}}, + { + para54{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}}, ans54{[]int{1, 2, 3, 6, 9, 8, 7, 4, 5}}, }, - question54{ - para54{[][]int{[]int{1, 2, 3, 4}, []int{5, 6, 7, 8}, []int{9, 10, 11, 12}}}, + { + para54{[][]int{{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}}}, ans54{[]int{1, 2, 3, 4, 8, 12, 11, 10, 9, 5, 6, 7}}, }, } diff --git a/leetcode/0055.Jump-Game/55. Jump Game_test.go b/leetcode/0055.Jump-Game/55. Jump Game_test.go index 8dfd10b6..e4e47e31 100644 --- a/leetcode/0055.Jump-Game/55. Jump Game_test.go +++ b/leetcode/0055.Jump-Game/55. Jump Game_test.go @@ -26,11 +26,11 @@ func Test_Problem55(t *testing.T) { qs := []question55{ - question55{ + { para55{[]int{2, 3, 1, 1, 4}}, ans55{true}, }, - question55{ + { para55{[]int{3, 2, 1, 0, 4}}, ans55{false}, }, diff --git a/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go b/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go index 30232c71..25cd44ba 100644 --- a/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go +++ b/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go @@ -26,39 +26,39 @@ func Test_Problem56(t *testing.T) { qs := []question56{ - question56{ + { para56{[]Interval{}}, ans56{[]Interval{}}, }, - question56{ - para56{[]Interval{Interval{Start: 1, End: 3}, Interval{Start: 2, End: 6}, Interval{Start: 8, End: 10}, Interval{Start: 15, End: 18}}}, - ans56{[]Interval{Interval{Start: 1, End: 6}, Interval{Start: 8, End: 10}, Interval{Start: 15, End: 18}}}, + { + para56{[]Interval{{Start: 1, End: 3}, {Start: 2, End: 6}, {Start: 8, End: 10}, {Start: 15, End: 18}}}, + ans56{[]Interval{{Start: 1, End: 6}, {Start: 8, End: 10}, {Start: 15, End: 18}}}, }, - question56{ - para56{[]Interval{Interval{Start: 1, End: 4}, Interval{Start: 4, End: 5}}}, - ans56{[]Interval{Interval{Start: 1, End: 5}}}, + { + para56{[]Interval{{Start: 1, End: 4}, {Start: 4, End: 5}}}, + ans56{[]Interval{{Start: 1, End: 5}}}, }, - question56{ - para56{[]Interval{Interval{Start: 1, End: 3}, Interval{Start: 3, End: 6}, Interval{Start: 5, End: 10}, Interval{Start: 9, End: 18}}}, - ans56{[]Interval{Interval{Start: 1, End: 18}}}, + { + para56{[]Interval{{Start: 1, End: 3}, {Start: 3, End: 6}, {Start: 5, End: 10}, {Start: 9, End: 18}}}, + ans56{[]Interval{{Start: 1, End: 18}}}, }, - question56{ - para56{[]Interval{Interval{Start: 15, End: 18}, Interval{Start: 8, End: 10}, Interval{Start: 2, End: 6}, Interval{Start: 1, End: 3}}}, - ans56{[]Interval{Interval{Start: 1, End: 6}, Interval{Start: 8, End: 10}, Interval{Start: 15, End: 18}}}, + { + para56{[]Interval{{Start: 15, End: 18}, {Start: 8, End: 10}, {Start: 2, End: 6}, {Start: 1, End: 3}}}, + ans56{[]Interval{{Start: 1, End: 6}, {Start: 8, End: 10}, {Start: 15, End: 18}}}, }, - question56{ - para56{[]Interval{Interval{Start: 1, End: 3}, Interval{Start: 2, End: 6}, Interval{Start: 8, End: 10}, Interval{Start: 15, End: 18}}}, - ans56{[]Interval{Interval{Start: 1, End: 6}, Interval{Start: 8, End: 10}, Interval{Start: 15, End: 18}}}, + { + para56{[]Interval{{Start: 1, End: 3}, {Start: 2, End: 6}, {Start: 8, End: 10}, {Start: 15, End: 18}}}, + ans56{[]Interval{{Start: 1, End: 6}, {Start: 8, End: 10}, {Start: 15, End: 18}}}, }, - question56{ - para56{[]Interval{Interval{Start: 1, End: 4}, Interval{Start: 1, End: 5}}}, - ans56{[]Interval{Interval{Start: 1, End: 5}}}, + { + para56{[]Interval{{Start: 1, End: 4}, {Start: 1, End: 5}}}, + ans56{[]Interval{{Start: 1, End: 5}}}, }, } diff --git a/leetcode/0057.Insert-Interval/57. Insert Interval_test.go b/leetcode/0057.Insert-Interval/57. Insert Interval_test.go index 9ce3a7b3..8923829c 100644 --- a/leetcode/0057.Insert-Interval/57. Insert Interval_test.go +++ b/leetcode/0057.Insert-Interval/57. Insert Interval_test.go @@ -27,34 +27,34 @@ func Test_Problem57(t *testing.T) { qs := []question57{ - question57{ + { para57{[]Interval{}, Interval{}}, ans57{[]Interval{}}, }, - question57{ - para57{[]Interval{Interval{Start: 1, End: 3}, Interval{Start: 6, End: 9}}, Interval{Start: 4, End: 8}}, - ans57{[]Interval{Interval{Start: 1, End: 5}, Interval{Start: 6, End: 9}}}, + { + para57{[]Interval{{Start: 1, End: 3}, {Start: 6, End: 9}}, Interval{Start: 4, End: 8}}, + ans57{[]Interval{{Start: 1, End: 5}, {Start: 6, End: 9}}}, }, - question57{ - para57{[]Interval{Interval{Start: 1, End: 3}, Interval{Start: 6, End: 9}}, Interval{Start: 2, End: 5}}, - ans57{[]Interval{Interval{Start: 1, End: 5}, Interval{Start: 6, End: 9}}}, + { + para57{[]Interval{{Start: 1, End: 3}, {Start: 6, End: 9}}, Interval{Start: 2, End: 5}}, + ans57{[]Interval{{Start: 1, End: 5}, {Start: 6, End: 9}}}, }, - question57{ - para57{[]Interval{Interval{Start: 1, End: 2}, Interval{Start: 3, End: 5}, Interval{Start: 6, End: 7}, Interval{Start: 8, End: 10}, Interval{Start: 12, End: 16}}, Interval{Start: 4, End: 8}}, - ans57{[]Interval{Interval{Start: 1, End: 2}, Interval{Start: 3, End: 10}, Interval{Start: 12, End: 16}}}, + { + para57{[]Interval{{Start: 1, End: 2}, {Start: 3, End: 5}, {Start: 6, End: 7}, {Start: 8, End: 10}, {Start: 12, End: 16}}, Interval{Start: 4, End: 8}}, + ans57{[]Interval{{Start: 1, End: 2}, {Start: 3, End: 10}, {Start: 12, End: 16}}}, }, - question57{ - para57{[]Interval{Interval{Start: 1, End: 5}}, Interval{Start: 5, End: 7}}, - ans57{[]Interval{Interval{Start: 1, End: 7}}}, + { + para57{[]Interval{{Start: 1, End: 5}}, Interval{Start: 5, End: 7}}, + ans57{[]Interval{{Start: 1, End: 7}}}, }, - question57{ - para57{[]Interval{Interval{Start: 1, End: 2}, Interval{Start: 3, End: 5}, Interval{Start: 6, End: 7}, Interval{Start: 8, End: 10}, Interval{Start: 12, End: 16}}, Interval{Start: 9, End: 12}}, - ans57{[]Interval{Interval{Start: 1, End: 2}, Interval{Start: 3, End: 5}, Interval{Start: 6, End: 7}, Interval{Start: 8, End: 16}}}, + { + para57{[]Interval{{Start: 1, End: 2}, {Start: 3, End: 5}, {Start: 6, End: 7}, {Start: 8, End: 10}, {Start: 12, End: 16}}, Interval{Start: 9, End: 12}}, + ans57{[]Interval{{Start: 1, End: 2}, {Start: 3, End: 5}, {Start: 6, End: 7}, {Start: 8, End: 16}}}, }, } diff --git a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go index 8fc1def4..aa1657f0 100644 --- a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go +++ b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go @@ -5,13 +5,13 @@ func generateMatrix(n int) [][]int { return [][]int{} } if n == 1 { - return [][]int{[]int{1}} + return [][]int{{1}} } res, visit, round, x, y, spDir := make([][]int, n), make([][]int, n), 0, 0, 0, [][]int{ - []int{0, 1}, // 朝右 - []int{1, 0}, // 朝下 - []int{0, -1}, // 朝左 - []int{-1, 0}, // 朝上 + {0, 1}, // 朝右 + {1, 0}, // 朝下 + {0, -1}, // 朝左 + {-1, 0}, // 朝上 } for i := 0; i < n; i++ { visit[i] = make([]int, n) diff --git a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go index 8448ced6..be43c350 100644 --- a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go +++ b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go @@ -26,14 +26,14 @@ func Test_Problem59(t *testing.T) { qs := []question59{ - question59{ + { para59{3}, - ans59{[][]int{[]int{1, 2, 3}, []int{8, 9, 4}, []int{7, 6, 5}}}, + ans59{[][]int{{1, 2, 3}, {8, 9, 4}, {7, 6, 5}}}, }, - question59{ + { para59{4}, - ans59{[][]int{[]int{1, 2, 3, 4}, []int{12, 13, 14, 5}, []int{11, 16, 15, 6}, []int{10, 9, 8, 7}}}, + ans59{[][]int{{1, 2, 3, 4}, {12, 13, 14, 5}, {11, 16, 15, 6}, {10, 9, 8, 7}}}, }, } diff --git a/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go b/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go index 7e14fb4e..b9805ed2 100644 --- a/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go +++ b/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go @@ -27,12 +27,12 @@ func Test_Problem60(t *testing.T) { qs := []question60{ - question60{ + { para60{3, 3}, ans60{"213"}, }, - question60{ + { para60{4, 9}, ans60{"2314"}, }, diff --git a/leetcode/0061.Rotate-List/61. Rotate List_test.go b/leetcode/0061.Rotate-List/61. Rotate List_test.go index 98f82957..7df9e550 100644 --- a/leetcode/0061.Rotate-List/61. Rotate List_test.go +++ b/leetcode/0061.Rotate-List/61. Rotate List_test.go @@ -29,32 +29,32 @@ func Test_Problem61(t *testing.T) { qs := []question61{ - question61{ + { para61{[]int{1, 2, 3, 4, 5}, 2}, ans61{[]int{4, 5, 1, 2, 3}}, }, - question61{ + { para61{[]int{1, 2, 3, 4, 5}, 3}, ans61{[]int{4, 5, 1, 2, 3}}, }, - question61{ + { para61{[]int{0, 1, 2}, 4}, ans61{[]int{2, 0, 1}}, }, - question61{ + { para61{[]int{1, 1, 1, 2}, 3}, ans61{[]int{1, 1, 2, 1}}, }, - question61{ + { para61{[]int{1}, 10}, ans61{[]int{1}}, }, - question61{ + { para61{[]int{}, 100}, ans61{[]int{}}, }, diff --git a/leetcode/0062.Unique-Paths/62. Unique Paths_test.go b/leetcode/0062.Unique-Paths/62. Unique Paths_test.go index 00fad12e..e5e7f657 100644 --- a/leetcode/0062.Unique-Paths/62. Unique Paths_test.go +++ b/leetcode/0062.Unique-Paths/62. Unique Paths_test.go @@ -27,17 +27,17 @@ func Test_Problem62(t *testing.T) { qs := []question62{ - question62{ + { para62{3, 2}, ans62{3}, }, - question62{ + { para62{7, 3}, ans62{28}, }, - question62{ + { para62{1, 2}, ans62{1}, }, diff --git a/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go b/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go index 03536295..e8bf8028 100644 --- a/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go +++ b/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go @@ -26,29 +26,29 @@ func Test_Problem63(t *testing.T) { qs := []question63{ - question63{ + { para63{[][]int{ - []int{0, 0, 0}, - []int{0, 1, 0}, - []int{0, 0, 0}, + {0, 0, 0}, + {0, 1, 0}, + {0, 0, 0}, }}, ans63{2}, }, - question63{ + { para63{[][]int{ - []int{0, 0}, - []int{1, 1}, - []int{0, 0}, + {0, 0}, + {1, 1}, + {0, 0}, }}, ans63{0}, }, - question63{ + { para63{[][]int{ - []int{0, 1, 0, 0}, - []int{1, 0, 0, 0}, - []int{0, 0, 0, 0}, + {0, 1, 0, 0}, + {1, 0, 0, 0}, + {0, 0, 0, 0}, }}, ans63{0}, }, diff --git a/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go b/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go index ab560530..afbfcacd 100644 --- a/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go +++ b/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go @@ -26,11 +26,11 @@ func Test_Problem64(t *testing.T) { qs := []question64{ - question64{ + { para64{[][]int{ - []int{1, 3, 1}, - []int{1, 5, 1}, - []int{4, 2, 1}, + {1, 3, 1}, + {1, 5, 1}, + {4, 2, 1}, }}, ans64{7}, }, diff --git a/leetcode/0066.Plus-One/66. Plus One_test.go b/leetcode/0066.Plus-One/66. Plus One_test.go index 0a72dea8..cc112f4d 100644 --- a/leetcode/0066.Plus-One/66. Plus One_test.go +++ b/leetcode/0066.Plus-One/66. Plus One_test.go @@ -26,22 +26,22 @@ func Test_Problem66(t *testing.T) { qs := []question66{ - question66{ + { para66{[]int{1, 2, 3}}, ans66{[]int{1, 2, 4}}, }, - question66{ + { para66{[]int{4, 3, 2, 1}}, ans66{[]int{4, 3, 2, 2}}, }, - question66{ + { para66{[]int{9, 9}}, ans66{[]int{1, 0, 0}}, }, - question66{ + { para66{[]int{0}}, ans66{[]int{0}}, }, diff --git a/leetcode/0067.Add-Binary/67. Add Binary_test.go b/leetcode/0067.Add-Binary/67. Add Binary_test.go index 50746ef5..29adc0cd 100644 --- a/leetcode/0067.Add-Binary/67. Add Binary_test.go +++ b/leetcode/0067.Add-Binary/67. Add Binary_test.go @@ -27,12 +27,12 @@ func Test_Problem67(t *testing.T) { qs := []question67{ - question67{ + { para67{"11", "1"}, ans67{"100"}, }, - question67{ + { para67{"1010", "1011"}, ans67{"10101"}, }, diff --git a/leetcode/0069.Sqrtx/69. Sqrt(x)_test.go b/leetcode/0069.Sqrtx/69. Sqrt(x)_test.go index 69e59cfc..b3188348 100644 --- a/leetcode/0069.Sqrtx/69. Sqrt(x)_test.go +++ b/leetcode/0069.Sqrtx/69. Sqrt(x)_test.go @@ -26,12 +26,12 @@ func Test_Problem69(t *testing.T) { qs := []question69{ - question69{ + { para69{4}, ans69{2}, }, - question69{ + { para69{8}, ans69{2}, }, diff --git a/leetcode/0070.Climbing-Stairs/70. Climbing Stairs_test.go b/leetcode/0070.Climbing-Stairs/70. Climbing Stairs_test.go index b574248d..02634ec3 100644 --- a/leetcode/0070.Climbing-Stairs/70. Climbing Stairs_test.go +++ b/leetcode/0070.Climbing-Stairs/70. Climbing Stairs_test.go @@ -26,12 +26,12 @@ func Test_Problem70(t *testing.T) { qs := []question70{ - question70{ + { para70{2}, ans70{2}, }, - question70{ + { para70{3}, ans70{3}, }, diff --git a/leetcode/0071.Simplify-Path/71. Simplify Path_test.go b/leetcode/0071.Simplify-Path/71. Simplify Path_test.go index 65dd575a..58376921 100644 --- a/leetcode/0071.Simplify-Path/71. Simplify Path_test.go +++ b/leetcode/0071.Simplify-Path/71. Simplify Path_test.go @@ -26,42 +26,42 @@ func Test_Problem71(t *testing.T) { qs := []question71{ - question71{ + { para71{"/.hidden"}, ans71{"/.hidden"}, }, - question71{ + { para71{"/..hidden"}, ans71{"/..hidden"}, }, - question71{ + { para71{"/abc/..."}, ans71{"/abc/..."}, }, - question71{ + { para71{"/home/"}, ans71{"/home"}, }, - question71{ + { para71{"/..."}, ans71{"/..."}, }, - question71{ + { para71{"/../"}, ans71{"/"}, }, - question71{ + { para71{"/home//foo/"}, ans71{"/home/foo"}, }, - question71{ + { para71{"/a/./b/../../c/"}, ans71{"/c"}, }, diff --git a/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go b/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go index 8890b289..9bca5b95 100644 --- a/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go +++ b/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go @@ -27,13 +27,13 @@ func Test_Problem74(t *testing.T) { qs := []question74{ - question74{ - para74{[][]int{[]int{1, 3, 5, 7}, []int{10, 11, 16, 20}, []int{23, 30, 34, 50}}, 3}, + { + para74{[][]int{{1, 3, 5, 7}, {10, 11, 16, 20}, {23, 30, 34, 50}}, 3}, ans74{true}, }, - question74{ - para74{[][]int{[]int{1, 3, 5, 7}, []int{10, 11, 16, 20}, []int{23, 30, 34, 50}}, 13}, + { + para74{[][]int{{1, 3, 5, 7}, {10, 11, 16, 20}, {23, 30, 34, 50}}, 13}, ans74{false}, }, } diff --git a/leetcode/0075.Sort-Colors/75. Sort Colors_test.go b/leetcode/0075.Sort-Colors/75. Sort Colors_test.go index 26ad2003..6feecf3a 100644 --- a/leetcode/0075.Sort-Colors/75. Sort Colors_test.go +++ b/leetcode/0075.Sort-Colors/75. Sort Colors_test.go @@ -26,22 +26,22 @@ func Test_Problem75(t *testing.T) { qs := []question75{ - question75{ + { para75{[]int{}}, ans75{[]int{}}, }, - question75{ + { para75{[]int{1}}, ans75{[]int{1}}, }, - question75{ + { para75{[]int{2, 0, 2, 1, 1, 0}}, ans75{[]int{0, 0, 1, 1, 2, 2}}, }, - question75{ + { para75{[]int{2, 0, 1, 1, 2, 0, 2, 1, 2, 0, 0, 0, 1, 2, 2, 2, 0, 1, 1}}, ans75{[]int{0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2}}, }, diff --git a/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go b/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go index 73338f49..95076c7a 100644 --- a/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go +++ b/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go @@ -27,17 +27,17 @@ func Test_Problem76(t *testing.T) { qs := []question76{ - question76{ + { para76{"ADOBECODEBANC", "ABC"}, ans76{"BANC"}, }, - question76{ + { para76{"a", "aa"}, ans76{""}, }, - question76{ + { para76{"a", "a"}, ans76{"a"}, }, diff --git a/leetcode/0077.Combinations/77. Combinations_test.go b/leetcode/0077.Combinations/77. Combinations_test.go index a5da8b93..4d1a14f3 100644 --- a/leetcode/0077.Combinations/77. Combinations_test.go +++ b/leetcode/0077.Combinations/77. Combinations_test.go @@ -27,9 +27,9 @@ func Test_Problem77(t *testing.T) { qs := []question77{ - question77{ + { para77{4, 2}, - ans77{[][]int{[]int{2, 4}, []int{3, 4}, []int{2, 3}, []int{1, 2}, []int{1, 3}, []int{1, 4}}}, + ans77{[][]int{{2, 4}, {3, 4}, {2, 3}, {1, 2}, {1, 3}, {1, 4}}}, }, } diff --git a/leetcode/0078.Subsets/78. Subsets_test.go b/leetcode/0078.Subsets/78. Subsets_test.go index 462ea24d..434f61cb 100644 --- a/leetcode/0078.Subsets/78. Subsets_test.go +++ b/leetcode/0078.Subsets/78. Subsets_test.go @@ -26,14 +26,14 @@ func Test_Problem78(t *testing.T) { qs := []question78{ - question78{ + { para78{[]int{}}, - ans78{[][]int{[]int{}}}, + ans78{[][]int{{}}}, }, - question78{ + { para78{[]int{1, 2, 3}}, - ans78{[][]int{[]int{}, []int{1}, []int{2}, []int{3}, []int{1, 2}, []int{2, 3}, []int{1, 3}, []int{1, 2, 3}}}, + ans78{[][]int{{}, {1}, {2}, {3}, {1, 2}, {2, 3}, {1, 3}, {1, 2, 3}}}, }, } diff --git a/leetcode/0079.Word-Search/79. Word Search.go b/leetcode/0079.Word-Search/79. Word Search.go index 6a6bbca5..a2bd2207 100644 --- a/leetcode/0079.Word-Search/79. Word Search.go +++ b/leetcode/0079.Word-Search/79. Word Search.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func exist(board [][]byte, word string) bool { diff --git a/leetcode/0079.Word-Search/79. Word Search_test.go b/leetcode/0079.Word-Search/79. Word Search_test.go index ae47e951..85d992c3 100644 --- a/leetcode/0079.Word-Search/79. Word Search_test.go +++ b/leetcode/0079.Word-Search/79. Word Search_test.go @@ -27,69 +27,69 @@ func Test_Problem79(t *testing.T) { qs := []question79{ - question79{ + { para79{[][]byte{ - []byte{'A', 'B', 'C', 'E'}, - []byte{'S', 'F', 'C', 'S'}, - []byte{'A', 'D', 'E', 'E'}, + {'A', 'B', 'C', 'E'}, + {'S', 'F', 'C', 'S'}, + {'A', 'D', 'E', 'E'}, }, "ABCCED"}, ans79{true}, }, - question79{ + { para79{[][]byte{ - []byte{'A', 'B', 'C', 'E'}, - []byte{'S', 'F', 'C', 'S'}, - []byte{'A', 'D', 'E', 'E'}, + {'A', 'B', 'C', 'E'}, + {'S', 'F', 'C', 'S'}, + {'A', 'D', 'E', 'E'}, }, "SEE"}, ans79{true}, }, - question79{ + { para79{[][]byte{ - []byte{'A', 'B', 'C', 'E'}, - []byte{'S', 'F', 'C', 'S'}, - []byte{'A', 'D', 'E', 'E'}, + {'A', 'B', 'C', 'E'}, + {'S', 'F', 'C', 'S'}, + {'A', 'D', 'E', 'E'}, }, "ABCB"}, ans79{false}, }, - question79{ + { para79{[][]byte{ - []byte{'o', 'a', 'a', 'n'}, - []byte{'e', 't', 'a', 'e'}, - []byte{'i', 'h', 'k', 'r'}, - []byte{'i', 'f', 'l', 'v'}, + {'o', 'a', 'a', 'n'}, + {'e', 't', 'a', 'e'}, + {'i', 'h', 'k', 'r'}, + {'i', 'f', 'l', 'v'}, }, "oath"}, ans79{true}, }, - question79{ + { para79{[][]byte{ - []byte{'o', 'a', 'a', 'n'}, - []byte{'e', 't', 'a', 'e'}, - []byte{'i', 'h', 'k', 'r'}, - []byte{'i', 'f', 'l', 'v'}, + {'o', 'a', 'a', 'n'}, + {'e', 't', 'a', 'e'}, + {'i', 'h', 'k', 'r'}, + {'i', 'f', 'l', 'v'}, }, "pea"}, ans79{false}, }, - question79{ + { para79{[][]byte{ - []byte{'o', 'a', 'a', 'n'}, - []byte{'e', 't', 'a', 'e'}, - []byte{'i', 'h', 'k', 'r'}, - []byte{'i', 'f', 'l', 'v'}, + {'o', 'a', 'a', 'n'}, + {'e', 't', 'a', 'e'}, + {'i', 'h', 'k', 'r'}, + {'i', 'f', 'l', 'v'}, }, "eat"}, ans79{true}, }, - question79{ + { para79{[][]byte{ - []byte{'o', 'a', 'a', 'n'}, - []byte{'e', 't', 'a', 'e'}, - []byte{'i', 'h', 'k', 'r'}, - []byte{'i', 'f', 'l', 'v'}, + {'o', 'a', 'a', 'n'}, + {'e', 't', 'a', 'e'}, + {'i', 'h', 'k', 'r'}, + {'i', 'f', 'l', 'v'}, }, "rain"}, ans79{false}, }, diff --git a/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go b/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go index 4b8227b0..ae6e64c5 100644 --- a/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go +++ b/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go @@ -4,9 +4,9 @@ func removeDuplicates80(nums []int) int { if len(nums) == 0 { return 0 } - last, finder, startFinder := 0, 0, -1 + last, finder := 0, 0 for last < len(nums)-1 { - startFinder = -1 + startFinder := -1 for nums[finder] == nums[last] { if startFinder == -1 || startFinder > finder { startFinder = finder diff --git a/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II_test.go b/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II_test.go index 3e2e2dce..f64d4c86 100644 --- a/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II_test.go +++ b/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II_test.go @@ -26,32 +26,32 @@ func Test_Problem80(t *testing.T) { qs := []question80{ - question80{ + { para80{[]int{1, 1, 2}}, ans80{3}, }, - question80{ + { para80{[]int{0, 0, 1, 1, 1, 1, 2, 3, 4, 4}}, ans80{8}, }, - question80{ + { para80{[]int{0, 0, 0, 0, 0}}, ans80{2}, }, - question80{ + { para80{[]int{1}}, ans80{1}, }, - question80{ + { para80{[]int{0, 0, 1, 1, 1, 1, 2, 3, 3}}, ans80{7}, }, - question80{ + { para80{[]int{1, 1, 1, 1, 2, 2, 3}}, ans80{5}, }, diff --git a/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go b/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go index 9e90576e..ba089f42 100644 --- a/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go +++ b/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go @@ -27,12 +27,12 @@ func Test_Problem81(t *testing.T) { qs := []question81{ - question81{ + { para81{[]int{2, 5, 6, 0, 0, 1, 2}, 0}, ans81{true}, }, - question81{ + { para81{[]int{2, 5, 6, 0, 0, 1, 2}, 3}, ans81{false}, }, diff --git a/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go b/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go index b9631bde..5bfd3ec2 100644 --- a/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go +++ b/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go @@ -28,47 +28,47 @@ func Test_Problem82(t *testing.T) { qs := []question82{ - question82{ + { para82{[]int{1, 1, 2, 2, 3, 4, 4, 4}}, ans82{[]int{3}}, }, - question82{ + { para82{[]int{1, 1, 1, 1, 1, 1}}, ans82{[]int{}}, }, - question82{ + { para82{[]int{1, 1, 1, 2, 3}}, ans82{[]int{2, 3}}, }, - question82{ + { para82{[]int{1}}, ans82{[]int{1}}, }, - question82{ + { para82{[]int{}}, ans82{[]int{}}, }, - question82{ + { para82{[]int{1, 2, 2, 2, 2}}, ans82{[]int{1}}, }, - question82{ + { para82{[]int{1, 1, 2, 3, 3, 4, 5, 5, 6}}, ans82{[]int{2, 4, 6}}, }, - question82{ + { para82{[]int{1, 1, 2, 3, 3, 4, 5, 6}}, ans82{[]int{2, 4, 5, 6}}, }, - question82{ + { para82{[]int{0, 1, 2, 2, 3, 4}}, ans82{[]int{0, 1, 2, 2, 3, 4}}, }, diff --git a/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go b/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go index 4d1e9fd9..2feb9fee 100644 --- a/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go +++ b/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go @@ -28,17 +28,17 @@ func Test_Problem83(t *testing.T) { qs := []question83{ - question83{ + { para83{[]int{1, 1, 2}}, ans83{[]int{1, 2}}, }, - question83{ + { para83{[]int{1, 1, 2, 2, 3, 3, 3}}, ans83{[]int{1, 2, 3}}, }, - question83{ + { para83{[]int{1, 1, 1, 1, 1, 1, 1, 1}}, ans83{[]int{1}}, }, diff --git a/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram_test.go b/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram_test.go index 65f0621e..7226916a 100644 --- a/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram_test.go +++ b/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram_test.go @@ -26,17 +26,17 @@ func Test_Problem84(t *testing.T) { qs := []question84{ - question84{ + { para84{[]int{2, 1, 5, 6, 2, 3}}, ans84{10}, }, - question84{ + { para84{[]int{1}}, ans84{1}, }, - question84{ + { para84{[]int{1, 1}}, ans84{2}, }, diff --git a/leetcode/0086.Partition-List/86. Partition List_test.go b/leetcode/0086.Partition-List/86. Partition List_test.go index 2ea1d618..4fd4e5f7 100644 --- a/leetcode/0086.Partition-List/86. Partition List_test.go +++ b/leetcode/0086.Partition-List/86. Partition List_test.go @@ -29,37 +29,37 @@ func Test_Problem86(t *testing.T) { qs := []question86{ - question86{ + { para86{[]int{1, 4, 3, 2, 5, 2}, 3}, ans86{[]int{1, 2, 2, 4, 3, 5}}, }, - question86{ + { para86{[]int{1, 1, 2, 2, 3, 3, 3}, 2}, ans86{[]int{1, 1, 2, 2, 3, 3, 3}}, }, - question86{ + { para86{[]int{1, 4, 3, 2, 5, 2}, 0}, ans86{[]int{1, 4, 3, 2, 5, 2}}, }, - question86{ + { para86{[]int{4, 3, 2, 5, 2}, 3}, ans86{[]int{2, 2, 4, 3, 5}}, }, - question86{ + { para86{[]int{1, 1, 1, 1, 1, 1}, 1}, ans86{[]int{1, 1, 1, 1, 1, 1}}, }, - question86{ + { para86{[]int{3, 1}, 2}, ans86{[]int{1, 3}}, }, - question86{ + { para86{[]int{1, 2}, 3}, ans86{[]int{1, 2}}, }, diff --git a/leetcode/0088.Merge-Sorted-Array/88. Merge Sorted Array_test.go b/leetcode/0088.Merge-Sorted-Array/88. Merge Sorted Array_test.go index 3d078d12..c27ca41e 100644 --- a/leetcode/0088.Merge-Sorted-Array/88. Merge Sorted Array_test.go +++ b/leetcode/0088.Merge-Sorted-Array/88. Merge Sorted Array_test.go @@ -44,7 +44,7 @@ func Test_Problem88(t *testing.T) { // ans{[]int{1, 2, 2, 3}}, // }, - question88{ + { para88{[]int{1, 2, 3, 0, 0, 0}, 3, []int{2, 5, 6}, 3}, ans88{[]int{1, 2, 2, 3, 5, 6}}, }, diff --git a/leetcode/0089.Gray-Code/89. Gray Code_test.go b/leetcode/0089.Gray-Code/89. Gray Code_test.go index 80da647f..5d27d3dc 100644 --- a/leetcode/0089.Gray-Code/89. Gray Code_test.go +++ b/leetcode/0089.Gray-Code/89. Gray Code_test.go @@ -26,17 +26,17 @@ func Test_Problem89(t *testing.T) { qs := []question89{ - question89{ + { para89{2}, ans89{[]int{0, 1, 3, 2}}, }, - question89{ + { para89{0}, ans89{[]int{0}}, }, - question89{ + { para89{3}, ans89{[]int{0, 1, 3, 2, 6, 7, 5, 4}}, }, diff --git a/leetcode/0090.Subsets-II/90. Subsets II_test.go b/leetcode/0090.Subsets-II/90. Subsets II_test.go index 8a5c1b9b..6b099e76 100644 --- a/leetcode/0090.Subsets-II/90. Subsets II_test.go +++ b/leetcode/0090.Subsets-II/90. Subsets II_test.go @@ -26,14 +26,14 @@ func Test_Problem90(t *testing.T) { qs := []question90{ - question90{ + { para90{[]int{}}, - ans90{[][]int{[]int{}}}, + ans90{[][]int{{}}}, }, - question90{ + { para90{[]int{1, 2, 2}}, - ans90{[][]int{[]int{}, []int{1}, []int{2}, []int{1, 2}, []int{2, 2}, []int{1, 2, 2}}}, + ans90{[][]int{{}, {1}, {2}, {1, 2}, {2, 2}, {1, 2, 2}}}, }, } diff --git a/leetcode/0091.Decode-Ways/91. Decode Ways_test.go b/leetcode/0091.Decode-Ways/91. Decode Ways_test.go index 584cfcb9..2e274069 100644 --- a/leetcode/0091.Decode-Ways/91. Decode Ways_test.go +++ b/leetcode/0091.Decode-Ways/91. Decode Ways_test.go @@ -26,12 +26,12 @@ func Test_Problem91(t *testing.T) { qs := []question91{ - question91{ + { para91{"12"}, ans91{2}, }, - question91{ + { para91{"226"}, ans91{3}, }, diff --git a/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II_test.go b/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II_test.go index 35171501..a209bb26 100644 --- a/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II_test.go +++ b/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II_test.go @@ -29,32 +29,32 @@ func Test_Problem92(t *testing.T) { qs := []question92{ - question92{ + { para92{[]int{1, 2, 3, 4, 5}, 2, 4}, ans92{[]int{1, 4, 3, 2, 5}}, }, - question92{ + { para92{[]int{1, 2, 3, 4, 5}, 2, 2}, ans92{[]int{1, 2, 3, 4, 5}}, }, - question92{ + { para92{[]int{1, 2, 3, 4, 5}, 1, 5}, ans92{[]int{5, 4, 3, 2, 1}}, }, - question92{ + { para92{[]int{1, 2, 3, 4, 5, 6}, 3, 4}, ans92{[]int{1, 2, 4, 3, 5, 6}}, }, - question92{ + { para92{[]int{3, 5}, 1, 2}, ans92{[]int{5, 3}}, }, - question92{ + { para92{[]int{3}, 3, 5}, ans92{[]int{3}}, }, diff --git a/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go b/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go index f528a746..143b9892 100644 --- a/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go +++ b/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go @@ -26,17 +26,17 @@ func Test_Problem93(t *testing.T) { qs := []question93{ - question93{ + { para93{"25525511135"}, ans93{[]string{"255.255.11.135", "255.255.111.35"}}, }, - question93{ + { para93{"0000"}, ans93{[]string{"0.0.0.0"}}, }, - question93{ + { para93{"010010"}, ans93{[]string{"0.10.0.10", "0.100.1.0"}}, }, diff --git a/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal_test.go b/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal_test.go index 8ad80cdd..cb71b729 100644 --- a/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal_test.go +++ b/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal_test.go @@ -28,17 +28,17 @@ func Test_Problem94(t *testing.T) { qs := []question94{ - question94{ + { para94{[]int{}}, ans94{[]int{}}, }, - question94{ + { para94{[]int{1}}, ans94{[]int{1}}, }, - question94{ + { para94{[]int{1, structures.NULL, 2, 3}}, ans94{[]int{1, 2, 3}}, }, diff --git a/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go b/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go index d61737dc..27f4cf17 100644 --- a/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go +++ b/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go @@ -29,10 +29,9 @@ func generateBSTree(start, end int) []*TreeNode { tree = append(tree, nil) return tree } - left, right := []*TreeNode{}, []*TreeNode{} for i := start; i <= end; i++ { - left = generateBSTree(start, i-1) - right = generateBSTree(i+1, end) + left := generateBSTree(start, i-1) + right := generateBSTree(i+1, end) for _, l := range left { for _, r := range right { root := &TreeNode{Val: i, Left: l, Right: r} diff --git a/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go b/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go index ab04688a..3cac732d 100644 --- a/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go +++ b/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go @@ -28,19 +28,19 @@ func Test_Problem95(t *testing.T) { qs := []question95{ - question95{ + { para95{1}, - ans95{[]*TreeNode{&TreeNode{Val: 1, Left: nil, Right: nil}}}, + ans95{[]*TreeNode{{Val: 1, Left: nil, Right: nil}}}, }, - question95{ + { para95{3}, ans95{[]*TreeNode{ - &TreeNode{Val: 1, Left: nil, Right: &TreeNode{Val: 3, Left: &TreeNode{Val: 2, Left: nil, Right: nil}, Right: nil}}, - &TreeNode{Val: 1, Left: nil, Right: &TreeNode{Val: 2, Left: nil, Right: &TreeNode{Val: 3, Left: nil, Right: nil}}}, - &TreeNode{Val: 3, Left: &TreeNode{Val: 2, Left: &TreeNode{Val: 1, Left: nil, Right: nil}, Right: nil}, Right: nil}, - &TreeNode{Val: 3, Left: &TreeNode{Val: 1, Left: nil, Right: &TreeNode{Val: 2, Left: nil, Right: nil}}, Right: nil}, - &TreeNode{Val: 2, Left: &TreeNode{Val: 1, Left: nil, Right: nil}, Right: &TreeNode{Val: 3, Left: nil, Right: nil}}, + {Val: 1, Left: nil, Right: &TreeNode{Val: 3, Left: &TreeNode{Val: 2, Left: nil, Right: nil}, Right: nil}}, + {Val: 1, Left: nil, Right: &TreeNode{Val: 2, Left: nil, Right: &TreeNode{Val: 3, Left: nil, Right: nil}}}, + {Val: 3, Left: &TreeNode{Val: 2, Left: &TreeNode{Val: 1, Left: nil, Right: nil}, Right: nil}, Right: nil}, + {Val: 3, Left: &TreeNode{Val: 1, Left: nil, Right: &TreeNode{Val: 2, Left: nil, Right: nil}}, Right: nil}, + {Val: 2, Left: &TreeNode{Val: 1, Left: nil, Right: nil}, Right: &TreeNode{Val: 3, Left: nil, Right: nil}}, }}}, } diff --git a/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees_test.go b/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees_test.go index e573c196..dcf36458 100644 --- a/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees_test.go +++ b/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees_test.go @@ -26,46 +26,46 @@ func Test_Problem96(t *testing.T) { qs := []question96{ - question96{ + { para96{1}, ans96{1}, }, - question96{ + { para96{3}, ans96{5}, }, - question96{ + { para96{4}, ans96{14}, }, - question96{ + { para96{5}, ans96{42}, }, - question96{ + { para96{6}, ans96{132}, }, - question96{ + { para96{7}, ans96{429}, }, - question96{ + { para96{8}, ans96{1430}, }, - question96{ + { para96{9}, ans96{4862}, }, - question96{ + { para96{10}, ans96{16796}, }, diff --git a/leetcode/0098.Validate-Binary-Search-Tree/98. Validate Binary Search Tree_test.go b/leetcode/0098.Validate-Binary-Search-Tree/98. Validate Binary Search Tree_test.go index 9f567af5..e9063d34 100644 --- a/leetcode/0098.Validate-Binary-Search-Tree/98. Validate Binary Search Tree_test.go +++ b/leetcode/0098.Validate-Binary-Search-Tree/98. Validate Binary Search Tree_test.go @@ -28,22 +28,22 @@ func Test_Problem98(t *testing.T) { qs := []question98{ - question98{ + { para98{[]int{10, 5, 15, structures.NULL, structures.NULL, 6, 20}}, ans98{false}, }, - question98{ + { para98{[]int{}}, ans98{true}, }, - question98{ + { para98{[]int{2, 1, 3}}, ans98{true}, }, - question98{ + { para98{[]int{5, 1, 4, structures.NULL, structures.NULL, 3, 6}}, ans98{false}, }, diff --git a/leetcode/0099.Recover-Binary-Search-Tree/99. Recover Binary Search Tree_test.go b/leetcode/0099.Recover-Binary-Search-Tree/99. Recover Binary Search Tree_test.go index 1830affc..958c2341 100644 --- a/leetcode/0099.Recover-Binary-Search-Tree/99. Recover Binary Search Tree_test.go +++ b/leetcode/0099.Recover-Binary-Search-Tree/99. Recover Binary Search Tree_test.go @@ -28,12 +28,12 @@ func Test_Problem99(t *testing.T) { qs := []question99{ - question99{ + { para99{[]int{1, 3, structures.NULL, structures.NULL, 2}}, ans99{[]int{3, 1, structures.NULL, structures.NULL, 2}}, }, - question99{ + { para99{[]int{3, 1, 4, structures.NULL, structures.NULL, 2}}, ans99{[]int{2, 1, 4, structures.NULL, structures.NULL, 3}}, }, diff --git a/leetcode/0100.Same-Tree/100. Same Tree_test.go b/leetcode/0100.Same-Tree/100. Same Tree_test.go index 7e727a03..e448f830 100644 --- a/leetcode/0100.Same-Tree/100. Same Tree_test.go +++ b/leetcode/0100.Same-Tree/100. Same Tree_test.go @@ -29,32 +29,32 @@ func Test_Problem100(t *testing.T) { qs := []question100{ - question100{ + { para100{[]int{}, []int{}}, ans100{true}, }, - question100{ + { para100{[]int{}, []int{1}}, ans100{false}, }, - question100{ + { para100{[]int{1}, []int{1}}, ans100{true}, }, - question100{ + { para100{[]int{1, 2, 3}, []int{1, 2, 3}}, ans100{true}, }, - question100{ + { para100{[]int{1, 2}, []int{1, structures.NULL, 2}}, ans100{false}, }, - question100{ + { para100{[]int{1, 2, 1}, []int{1, 1, 2}}, ans100{false}, }, diff --git a/leetcode/0101.Symmetric-Tree/101. Symmetric Tree_test.go b/leetcode/0101.Symmetric-Tree/101. Symmetric Tree_test.go index db0c69e2..fbf8293f 100644 --- a/leetcode/0101.Symmetric-Tree/101. Symmetric Tree_test.go +++ b/leetcode/0101.Symmetric-Tree/101. Symmetric Tree_test.go @@ -28,37 +28,37 @@ func Test_Problem101(t *testing.T) { qs := []question101{ - question101{ + { para101{[]int{3, 4, 4, 5, structures.NULL, structures.NULL, 5, 6, structures.NULL, structures.NULL, 6}}, ans101{true}, }, - question101{ + { para101{[]int{1, 2, 2, structures.NULL, 3, 3}}, ans101{true}, }, - question101{ + { para101{[]int{}}, ans101{true}, }, - question101{ + { para101{[]int{1}}, ans101{true}, }, - question101{ + { para101{[]int{1, 2, 3}}, ans101{false}, }, - question101{ + { para101{[]int{1, 2, 2, 3, 4, 4, 3}}, ans101{true}, }, - question101{ + { para101{[]int{1, 2, 2, structures.NULL, 3, structures.NULL, 3}}, ans101{false}, }, diff --git a/leetcode/0102.Binary-Tree-Level-Order-Traversal/102. Binary Tree Level Order Traversal_test.go b/leetcode/0102.Binary-Tree-Level-Order-Traversal/102. Binary Tree Level Order Traversal_test.go index cca627c1..190db881 100644 --- a/leetcode/0102.Binary-Tree-Level-Order-Traversal/102. Binary Tree Level Order Traversal_test.go +++ b/leetcode/0102.Binary-Tree-Level-Order-Traversal/102. Binary Tree Level Order Traversal_test.go @@ -28,19 +28,19 @@ func Test_Problem102(t *testing.T) { qs := []question102{ - question102{ + { para102{[]int{}}, ans102{[][]int{}}, }, - question102{ + { para102{[]int{1}}, - ans102{[][]int{[]int{1}}}, + ans102{[][]int{{1}}}, }, - question102{ + { para102{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, - ans102{[][]int{[]int{3}, []int{9, 20}, []int{15, 7}}}, + ans102{[][]int{{3}, {9, 20}, {15, 7}}}, }, } diff --git a/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal_test.go b/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal_test.go index 87cb1cb7..1b550698 100644 --- a/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal_test.go +++ b/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal_test.go @@ -28,24 +28,24 @@ func Test_Problem103(t *testing.T) { qs := []question103{ - question103{ + { para103{[]int{}}, ans103{[][]int{}}, }, - question103{ + { para103{[]int{1}}, - ans103{[][]int{[]int{1}}}, + ans103{[][]int{{1}}}, }, - question103{ + { para103{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, - ans103{[][]int{[]int{3}, []int{9, 20}, []int{15, 7}}}, + ans103{[][]int{{3}, {9, 20}, {15, 7}}}, }, - question103{ + { para103{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, 5}}, - ans103{[][]int{[]int{1}, []int{3, 2}, []int{4, 5}}}, + ans103{[][]int{{1}, {3, 2}, {4, 5}}}, }, } diff --git a/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go b/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go index 2c4380c8..a3ef5e1e 100644 --- a/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go +++ b/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go @@ -28,12 +28,12 @@ func Test_Problem104(t *testing.T) { qs := []question104{ - question104{ + { para104{[]int{}}, ans104{0}, }, - question104{ + { para104{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans104{3}, }, diff --git a/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal_test.go b/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal_test.go index b68fb74e..1bef0017 100644 --- a/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal_test.go +++ b/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal_test.go @@ -29,7 +29,7 @@ func Test_Problem105(t *testing.T) { qs := []question105{ - question105{ + { para105{[]int{3, 9, 20, 15, 7}, []int{9, 3, 15, 20, 7}}, ans105{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, }, diff --git a/leetcode/0106.Construct-Binary-Tree-from-Inorder-and-Postorder-Traversal/106. Construct Binary Tree from Inorder and Postorder Traversal_test.go b/leetcode/0106.Construct-Binary-Tree-from-Inorder-and-Postorder-Traversal/106. Construct Binary Tree from Inorder and Postorder Traversal_test.go index 0ff0ca69..eaa86c37 100644 --- a/leetcode/0106.Construct-Binary-Tree-from-Inorder-and-Postorder-Traversal/106. Construct Binary Tree from Inorder and Postorder Traversal_test.go +++ b/leetcode/0106.Construct-Binary-Tree-from-Inorder-and-Postorder-Traversal/106. Construct Binary Tree from Inorder and Postorder Traversal_test.go @@ -29,7 +29,7 @@ func Test_Problem106(t *testing.T) { qs := []question106{ - question106{ + { para106{[]int{9, 3, 15, 20, 7}, []int{9, 15, 7, 20, 3}}, ans106{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, }, diff --git a/leetcode/0107.Binary-Tree-Level-Order-Traversal-II/107. Binary Tree Level Order Traversal II_test.go b/leetcode/0107.Binary-Tree-Level-Order-Traversal-II/107. Binary Tree Level Order Traversal II_test.go index b167f65c..8978135d 100644 --- a/leetcode/0107.Binary-Tree-Level-Order-Traversal-II/107. Binary Tree Level Order Traversal II_test.go +++ b/leetcode/0107.Binary-Tree-Level-Order-Traversal-II/107. Binary Tree Level Order Traversal II_test.go @@ -28,19 +28,19 @@ func Test_Problem107(t *testing.T) { qs := []question107{ - question107{ + { para107{[]int{}}, ans107{[][]int{}}, }, - question107{ + { para107{[]int{1}}, - ans107{[][]int{[]int{1}}}, + ans107{[][]int{{1}}}, }, - question107{ + { para107{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, - ans107{[][]int{[]int{15, 7}, []int{9, 20}, []int{3}}}, + ans107{[][]int{{15, 7}, {9, 20}, {3}}}, }, } diff --git a/leetcode/0108.Convert-Sorted-Array-to-Binary-Search-Tree/108. Convert Sorted Array to Binary Search Tree_test.go b/leetcode/0108.Convert-Sorted-Array-to-Binary-Search-Tree/108. Convert Sorted Array to Binary Search Tree_test.go index 0cfdd5a3..44f4ae41 100644 --- a/leetcode/0108.Convert-Sorted-Array-to-Binary-Search-Tree/108. Convert Sorted Array to Binary Search Tree_test.go +++ b/leetcode/0108.Convert-Sorted-Array-to-Binary-Search-Tree/108. Convert Sorted Array to Binary Search Tree_test.go @@ -28,7 +28,7 @@ func Test_Problem108(t *testing.T) { qs := []question108{ - question108{ + { para108{[]int{-10, -3, 0, 5, 9}}, ans108{[]int{0, -3, 9, -10, structures.NULL, 5}}, }, diff --git a/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go b/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go index 10c36287..06f7f323 100644 --- a/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go +++ b/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go @@ -28,22 +28,22 @@ func Test_Problem109(t *testing.T) { qs := []question109{ - question109{ + { para109{[]int{-10, -3, 0, 5, 9}}, ans109{[]int{0, -10, 5, structures.NULL, -3, structures.NULL, 9}}, }, - question109{ + { para109{[]int{-10}}, ans109{[]int{-10}}, }, - question109{ + { para109{[]int{1, 2}}, ans109{[]int{1, 2}}, }, - question109{ + { para109{[]int{1, 2, 3}}, ans109{[]int{2, 1, 3}}, }, diff --git a/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree_test.go b/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree_test.go index 785e6313..2868cfcc 100644 --- a/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree_test.go +++ b/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree_test.go @@ -28,37 +28,37 @@ func Test_Problem110(t *testing.T) { qs := []question110{ - question110{ + { para110{[]int{3, 4, 4, 5, structures.NULL, structures.NULL, 5, 6, structures.NULL, structures.NULL, 6}}, ans110{false}, }, - question110{ + { para110{[]int{1, 2, 2, structures.NULL, 3, 3}}, ans110{true}, }, - question110{ + { para110{[]int{}}, ans110{true}, }, - question110{ + { para110{[]int{1}}, ans110{true}, }, - question110{ + { para110{[]int{1, 2, 3}}, ans110{true}, }, - question110{ + { para110{[]int{1, 2, 2, 3, 4, 4, 3}}, ans110{true}, }, - question110{ + { para110{[]int{1, 2, 2, structures.NULL, 3, structures.NULL, 3}}, ans110{true}, }, diff --git a/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go b/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go index 8cd759e3..a2a3753d 100644 --- a/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go +++ b/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go @@ -28,22 +28,22 @@ func Test_Problem111(t *testing.T) { qs := []question111{ - question111{ + { para111{[]int{}}, ans111{0}, }, - question111{ + { para111{[]int{1}}, ans111{1}, }, - question111{ + { para111{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans111{2}, }, - question111{ + { para111{[]int{1, 2}}, ans111{2}, }, diff --git a/leetcode/0112.Path-Sum/112. Path Sum_test.go b/leetcode/0112.Path-Sum/112. Path Sum_test.go index 7d50ede9..70168357 100644 --- a/leetcode/0112.Path-Sum/112. Path Sum_test.go +++ b/leetcode/0112.Path-Sum/112. Path Sum_test.go @@ -29,12 +29,12 @@ func Test_Problem112(t *testing.T) { qs := []question112{ - question112{ + { para112{[]int{}, 0}, ans112{false}, }, - question112{ + { para112{[]int{5, 4, 8, 11, structures.NULL, 13, 4, 7, 2, structures.NULL, structures.NULL, structures.NULL, 1}, 22}, ans112{true}, }, diff --git a/leetcode/0113.Path-Sum-II/113. Path Sum II.go b/leetcode/0113.Path-Sum-II/113. Path Sum II.go index 0cb5c044..6bca79a4 100644 --- a/leetcode/0113.Path-Sum-II/113. Path Sum II.go +++ b/leetcode/0113.Path-Sum-II/113. Path Sum II.go @@ -45,7 +45,7 @@ func pathSum1(root *TreeNode, sum int) [][]int { } if root.Left == nil && root.Right == nil { if sum == root.Val { - return [][]int{[]int{root.Val}} + return [][]int{{root.Val}} } } path, res := []int{}, [][]int{} diff --git a/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go b/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go index 6de18c28..e7520d11 100644 --- a/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go +++ b/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go @@ -28,19 +28,19 @@ type ans113 struct { func Test_Problem113(t *testing.T) { qs := []question113{ - question113{ + { para113{[]int{1, 0, 1, 1, 2, 0, -1, 0, 1, -1, 0, -1, 0, 1, 0}, 2}, - ans113{[][]int{[]int{1, 0, 1, 0}, []int{1, 0, 2, -1}, []int{1, 1, 0, 0}, []int{1, 1, -1, 1}}}, + ans113{[][]int{{1, 0, 1, 0}, {1, 0, 2, -1}, {1, 1, 0, 0}, {1, 1, -1, 1}}}, }, - question113{ + { para113{[]int{}, 0}, - ans113{[][]int{[]int{}}}, + ans113{[][]int{{}}}, }, - question113{ + { para113{[]int{5, 4, 8, 11, structures.NULL, 13, 4, 7, 2, structures.NULL, structures.NULL, 5, 1}, 22}, - ans113{[][]int{[]int{5, 4, 11, 2}, []int{5, 8, 4, 5}}}, + ans113{[][]int{{5, 4, 11, 2}, {5, 8, 4, 5}}}, }, } diff --git a/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go b/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go index a05d4dbc..29909396 100644 --- a/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go +++ b/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go @@ -28,7 +28,7 @@ func Test_Problem114(t *testing.T) { qs := []question114{ - question114{ + { para114{[]int{1, 2, 3, 4, 5, 6}}, ans114{[]int{1, 2, 3, 4, 5, 6}}, }, diff --git a/leetcode/0118.Pascals-Triangle/118. Pascal's Triangle_test.go b/leetcode/0118.Pascals-Triangle/118. Pascal's Triangle_test.go index 9130cd61..5b8e87a7 100644 --- a/leetcode/0118.Pascals-Triangle/118. Pascal's Triangle_test.go +++ b/leetcode/0118.Pascals-Triangle/118. Pascal's Triangle_test.go @@ -26,17 +26,17 @@ func Test_Problem118(t *testing.T) { qs := []question118{ - question118{ + { para118{2}, ans118{[][]int{{1}, {1, 1}}}, }, - question118{ + { para118{5}, ans118{[][]int{{1}, {1, 1}, {1, 2, 1}, {1, 3, 3, 1}, {1, 4, 6, 4, 1}}}, }, - question118{ + { para118{10}, ans118{[][]int{{1}, {1, 1}, {1, 2, 1}, {1, 3, 3, 1}, {1, 4, 6, 4, 1}, {1, 5, 10, 10, 5, 1}, {1, 6, 15, 20, 15, 6, 1}, {1, 7, 21, 35, 35, 21, 7, 1}, {1, 8, 28, 56, 70, 56, 28, 8, 1}, {1, 9, 36, 84, 126, 126, 84, 36, 9, 1}}}, }, diff --git a/leetcode/0120.Triangle/120. Triangle_test.go b/leetcode/0120.Triangle/120. Triangle_test.go index a7930103..2398cafe 100644 --- a/leetcode/0120.Triangle/120. Triangle_test.go +++ b/leetcode/0120.Triangle/120. Triangle_test.go @@ -25,8 +25,8 @@ type ans120 struct { func Test_Problem120(t *testing.T) { qs := []question120{ - question120{ - para120{[][]int{[]int{2}, []int{3, 4}, []int{6, 5, 7}, []int{4, 1, 8, 3}}}, + { + para120{[][]int{{2}, {3, 4}, {6, 5, 7}, {4, 1, 8, 3}}}, ans120{11}, }, } diff --git a/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock_test.go b/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock_test.go index 10e031e0..681161ed 100644 --- a/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock_test.go +++ b/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock_test.go @@ -26,22 +26,22 @@ func Test_Problem121(t *testing.T) { qs := []question121{ - question121{ + { para121{[]int{}}, ans121{0}, }, - question121{ + { para121{[]int{7, 1, 5, 3, 6, 4}}, ans121{5}, }, - question121{ + { para121{[]int{7, 6, 4, 3, 1}}, ans121{0}, }, - question121{ + { para121{[]int{1, 3, 2, 8, 4, 9}}, ans121{8}, }, diff --git a/leetcode/0122.Best-Time-to-Buy-and-Sell-Stock-II/122. Best Time to Buy and Sell Stock II_test.go b/leetcode/0122.Best-Time-to-Buy-and-Sell-Stock-II/122. Best Time to Buy and Sell Stock II_test.go index 009f44c4..dd58050f 100644 --- a/leetcode/0122.Best-Time-to-Buy-and-Sell-Stock-II/122. Best Time to Buy and Sell Stock II_test.go +++ b/leetcode/0122.Best-Time-to-Buy-and-Sell-Stock-II/122. Best Time to Buy and Sell Stock II_test.go @@ -26,27 +26,27 @@ func Test_Problem122(t *testing.T) { qs := []question122{ - question122{ + { para122{[]int{}}, ans122{0}, }, - question122{ + { para122{[]int{7, 1, 5, 3, 6, 4}}, ans122{7}, }, - question122{ + { para122{[]int{7, 6, 4, 3, 1}}, ans122{0}, }, - question122{ + { para122{[]int{1, 2, 3, 4, 5}}, ans122{4}, }, - question122{ + { para122{[]int{1, 2, 10, 11, 12, 15}}, ans122{14}, }, diff --git a/leetcode/0124.Binary-Tree-Maximum-Path-Sum/124. Binary Tree Maximum Path Sum_test.go b/leetcode/0124.Binary-Tree-Maximum-Path-Sum/124. Binary Tree Maximum Path Sum_test.go index a32dafec..7e57778c 100644 --- a/leetcode/0124.Binary-Tree-Maximum-Path-Sum/124. Binary Tree Maximum Path Sum_test.go +++ b/leetcode/0124.Binary-Tree-Maximum-Path-Sum/124. Binary Tree Maximum Path Sum_test.go @@ -28,22 +28,22 @@ func Test_Problem124(t *testing.T) { qs := []question124{ - question124{ + { para124{[]int{}}, ans124{0}, }, - question124{ + { para124{[]int{1}}, ans124{1}, }, - question124{ + { para124{[]int{1, 2, 3}}, ans124{6}, }, - question124{ + { para124{[]int{-10, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans124{42}, }, diff --git a/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go b/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go index 9745cabc..7859a7b3 100644 --- a/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go +++ b/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go @@ -27,12 +27,12 @@ type ans126 struct { func Test_Problem126(t *testing.T) { qs := []question126{ - question126{ + { para126{"hit", "cog", []string{"hot", "dot", "dog", "lot", "log", "cog"}}, - ans126{[][]string{[]string{"hit", "hot", "dot", "dog", "cog"}, []string{"hit", "hot", "lot", "log", "cog"}}}, + ans126{[][]string{{"hit", "hot", "dot", "dog", "cog"}, {"hit", "hot", "lot", "log", "cog"}}}, }, - question126{ + { para126{"hit", "cog", []string{"hot", "dot", "dog", "lot", "log"}}, ans126{[][]string{}}, }, diff --git a/leetcode/0127.Word-Ladder/127. Word Ladder_test.go b/leetcode/0127.Word-Ladder/127. Word Ladder_test.go index 59591fe0..64c5f13f 100644 --- a/leetcode/0127.Word-Ladder/127. Word Ladder_test.go +++ b/leetcode/0127.Word-Ladder/127. Word Ladder_test.go @@ -27,12 +27,12 @@ type ans127 struct { func Test_Problem127(t *testing.T) { qs := []question127{ - question127{ + { para127{"hit", "cog", []string{"hot", "dot", "dog", "lot", "log", "cog"}}, ans127{5}, }, - question127{ + { para127{"hit", "cog", []string{"hot", "dot", "dog", "lot", "log"}}, ans127{0}, }, diff --git a/leetcode/0128.Longest-Consecutive-Sequence/128. Longest Consecutive Sequence_test.go b/leetcode/0128.Longest-Consecutive-Sequence/128. Longest Consecutive Sequence_test.go index 0b769241..1e2ee31d 100644 --- a/leetcode/0128.Longest-Consecutive-Sequence/128. Longest Consecutive Sequence_test.go +++ b/leetcode/0128.Longest-Consecutive-Sequence/128. Longest Consecutive Sequence_test.go @@ -26,27 +26,27 @@ func Test_Problem128(t *testing.T) { qs := []question128{ - question128{ + { para128{[]int{}}, ans128{0}, }, - question128{ + { para128{[]int{0}}, ans128{1}, }, - question128{ + { para128{[]int{9, 1, 4, 7, 3, -1, 0, 5, 8, -1, 6}}, ans128{7}, }, - question128{ + { para128{[]int{2147483646, -2147483647, 0, 2, 2147483644, -2147483645, 2147483645}}, ans128{3}, }, - question128{ + { para128{[]int{100, 4, 200, 1, 3, 2}}, ans128{4}, }, diff --git a/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers_test.go b/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers_test.go index b1cd76d4..0b50a662 100644 --- a/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers_test.go +++ b/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers_test.go @@ -28,17 +28,17 @@ func Test_Problem129(t *testing.T) { qs := []question129{ - question129{ + { para129{[]int{}}, ans129{0}, }, - question129{ + { para129{[]int{1, 2, 3}}, ans129{25}, }, - question129{ + { para129{[]int{4, 9, 0, 5, 1}}, ans129{1026}, }, diff --git a/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go b/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go index e7a4628f..9d904e36 100644 --- a/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go +++ b/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go @@ -5,10 +5,10 @@ import ( ) var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } // 解法一 并查集 diff --git a/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go b/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go index a363b5f0..1dec2ced 100644 --- a/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go +++ b/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go @@ -26,14 +26,14 @@ func Test_Problem130(t *testing.T) { qs := []question130{ - question130{ + { para130{[][]byte{}}, ans130{[][]byte{}}, }, - question130{ - para130{[][]byte{[]byte{'X', 'X', 'X', 'X'}, []byte{'X', 'O', 'O', 'X'}, []byte{'X', 'X', 'O', 'X'}, []byte{'X', 'O', 'X', 'X'}}}, - ans130{[][]byte{[]byte{'X', 'X', 'X', 'X'}, []byte{'X', 'X', 'X', 'X'}, []byte{'X', 'X', 'X', 'X'}, []byte{'X', 'O', 'X', 'X'}}}, + { + para130{[][]byte{{'X', 'X', 'X', 'X'}, {'X', 'O', 'O', 'X'}, {'X', 'X', 'O', 'X'}, {'X', 'O', 'X', 'X'}}}, + ans130{[][]byte{{'X', 'X', 'X', 'X'}, {'X', 'X', 'X', 'X'}, {'X', 'X', 'X', 'X'}, {'X', 'O', 'X', 'X'}}}, }, } diff --git a/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go b/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go index d482ce22..7008f7e2 100644 --- a/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go +++ b/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go @@ -26,24 +26,24 @@ func Test_Problem131(t *testing.T) { qs := []question131{ - question131{ + { para131{"aab"}, - ans131{[][]string{[]string{"aa", "b"}, []string{"a", "a", "b"}}}, + ans131{[][]string{{"aa", "b"}, {"a", "a", "b"}}}, }, - question131{ + { para131{"bb"}, - ans131{[][]string{[]string{"b", "b"}, []string{"bb"}}}, + ans131{[][]string{{"b", "b"}, {"bb"}}}, }, - question131{ + { para131{"efe"}, - ans131{[][]string{[]string{"e", "f", "e"}, []string{"efe"}}}, + ans131{[][]string{{"e", "f", "e"}, {"efe"}}}, }, - question131{ + { para131{"abbab"}, - ans131{[][]string{[]string{"a", "b", "b", "a", "b"}, []string{"a", "b", "bab"}, []string{"a", "bb", "a", "b"}, []string{"abba", "b"}}}, + ans131{[][]string{{"a", "b", "b", "a", "b"}, {"a", "b", "bab"}, {"a", "bb", "a", "b"}, {"abba", "b"}}}, }, } diff --git a/leetcode/0136.Single-Number/136. Single Number_test.go b/leetcode/0136.Single-Number/136. Single Number_test.go index fb2be390..2360a740 100644 --- a/leetcode/0136.Single-Number/136. Single Number_test.go +++ b/leetcode/0136.Single-Number/136. Single Number_test.go @@ -26,12 +26,12 @@ func Test_Problem136(t *testing.T) { qs := []question136{ - question136{ + { para136{[]int{2, 2, 1}}, ans136{1}, }, - question136{ + { para136{[]int{4, 1, 2, 1, 2}}, ans136{4}, }, diff --git a/leetcode/0137.Single-Number-II/137. Single Number II_test.go b/leetcode/0137.Single-Number-II/137. Single Number II_test.go index f637f0bb..55c61803 100644 --- a/leetcode/0137.Single-Number-II/137. Single Number II_test.go +++ b/leetcode/0137.Single-Number-II/137. Single Number II_test.go @@ -26,12 +26,12 @@ func Test_Problem137(t *testing.T) { qs := []question137{ - question137{ + { para137{[]int{2, 2, 3, 2}}, ans137{3}, }, - question137{ + { para137{[]int{0, 1, 0, 1, 0, 1, 99}}, ans137{99}, }, diff --git a/leetcode/0143.Reorder-List/143. Reorder List_test.go b/leetcode/0143.Reorder-List/143. Reorder List_test.go index 0e470c04..d8363de5 100644 --- a/leetcode/0143.Reorder-List/143. Reorder List_test.go +++ b/leetcode/0143.Reorder-List/143. Reorder List_test.go @@ -28,21 +28,21 @@ func Test_Problem143(t *testing.T) { qs := []question143{ - question143{ + { para143{[]int{1, 2, 3, 4, 5}}, ans143{[]int{1, 5, 2, 4, 3}}, }, - question143{ + { para143{[]int{1, 2, 3, 4}}, ans143{[]int{1, 4, 2, 3}}, }, - question143{ + { para143{[]int{1}}, ans143{[]int{1}}, }, - question143{ + { para143{[]int{}}, ans143{[]int{}}, }, diff --git a/leetcode/0144.Binary-Tree-Preorder-Traversal/144. Binary Tree Preorder Traversal_test.go b/leetcode/0144.Binary-Tree-Preorder-Traversal/144. Binary Tree Preorder Traversal_test.go index 965129a1..c66a5474 100644 --- a/leetcode/0144.Binary-Tree-Preorder-Traversal/144. Binary Tree Preorder Traversal_test.go +++ b/leetcode/0144.Binary-Tree-Preorder-Traversal/144. Binary Tree Preorder Traversal_test.go @@ -28,17 +28,17 @@ func Test_Problem144(t *testing.T) { qs := []question144{ - question144{ + { para144{[]int{}}, ans144{[]int{}}, }, - question144{ + { para144{[]int{1}}, ans144{[]int{1}}, }, - question144{ + { para144{[]int{1, structures.NULL, 2, 3}}, ans144{[]int{1, 2, 3}}, }, diff --git a/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal_test.go b/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal_test.go index f7896413..37a1ef3c 100644 --- a/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal_test.go +++ b/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal_test.go @@ -28,17 +28,17 @@ func Test_Problem145(t *testing.T) { qs := []question145{ - question145{ + { para145{[]int{}}, ans145{[]int{}}, }, - question145{ + { para145{[]int{1}}, ans145{[]int{1}}, }, - question145{ + { para145{[]int{1, structures.NULL, 2, 3}}, ans145{[]int{1, 2, 3}}, }, diff --git a/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go b/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go index 1b9f13ae..89ea6d7e 100644 --- a/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go +++ b/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go @@ -19,11 +19,9 @@ func insertionSortList(head *ListNode) *ListNode { return head } newHead := &ListNode{Val: 0, Next: nil} // 这里初始化不要直接指向 head，为了下面循环可以统一处理 - cur := head - pre := newHead - next := &ListNode{Val: 0, Next: nil} + cur, pre := head, newHead for cur != nil { - next = cur.Next + next := cur.Next for pre.Next != nil && pre.Next.Val < cur.Val { pre = pre.Next } diff --git a/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List_test.go b/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List_test.go index d619ae92..d1b0d395 100644 --- a/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List_test.go +++ b/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List_test.go @@ -28,21 +28,21 @@ func Test_Problem147(t *testing.T) { qs := []question147{ - question147{ + { para147{[]int{4, 2, 1, 3}}, ans147{[]int{1, 2, 3, 4}}, }, - question147{ + { para147{[]int{1}}, ans147{[]int{1}}, }, - question147{ + { para147{[]int{-1, 5, 3, 4, 0}}, ans147{[]int{-1, 0, 3, 4, 5}}, }, - question147{ + { para147{[]int{}}, ans147{[]int{}}, }, diff --git a/leetcode/0148.Sort-List/148. Sort List_test.go b/leetcode/0148.Sort-List/148. Sort List_test.go index d255cde8..11258c23 100644 --- a/leetcode/0148.Sort-List/148. Sort List_test.go +++ b/leetcode/0148.Sort-List/148. Sort List_test.go @@ -28,21 +28,21 @@ func Test_Problem148(t *testing.T) { qs := []question148{ - question148{ + { para148{[]int{1, 2, 3, 4, 5}}, ans148{[]int{1, 2, 3, 4, 5}}, }, - question148{ + { para148{[]int{1, 1, 2, 5, 5, 4, 10, 0}}, ans148{[]int{0, 1, 1, 2, 4, 5, 5}}, }, - question148{ + { para148{[]int{1}}, ans148{[]int{1}}, }, - question148{ + { para148{[]int{}}, ans148{[]int{}}, }, diff --git a/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go b/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go index 13339ae2..55fb4476 100644 --- a/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go +++ b/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go @@ -26,21 +26,21 @@ func Test_Problem150(t *testing.T) { qs := []question150{ - question150{ + { para150{[]string{"18"}}, ans150{18}, }, - question150{ + { para150{[]string{"2", "1", "+", "3", "*"}}, ans150{9}, }, - question150{ + { para150{[]string{"4", "13", "5", "/", "+"}}, ans150{6}, }, - question150{ + { para150{[]string{"10", "6", "9", "3", "+", "-11", "*", "/", "*", "17", "+", "5", "+"}}, ans150{22}, }, diff --git a/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String_test.go b/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String_test.go index aa5f48e0..195ac83d 100644 --- a/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String_test.go +++ b/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String_test.go @@ -26,16 +26,16 @@ func Test_Problem151(t *testing.T) { qs := []question151{ - question151{ + { para151{"the sky is blue"}, ans151{"blue is sky the"}, }, - question151{ + { para151{" hello world! "}, ans151{"world! hello"}, }, - question151{ + { para151{"a good example"}, ans151{"example good a"}, }, diff --git a/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray_test.go b/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray_test.go index e37728d7..12a77add 100644 --- a/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray_test.go +++ b/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray_test.go @@ -26,27 +26,27 @@ func Test_Problem152(t *testing.T) { qs := []question152{ - question152{ + { para152{[]int{-2}}, ans152{-2}, }, - question152{ + { para152{[]int{3, -1, 4}}, ans152{4}, }, - question152{ + { para152{[]int{0}}, ans152{0}, }, - question152{ + { para152{[]int{2, 3, -2, 4}}, ans152{6}, }, - question152{ + { para152{[]int{-2, 0, -1}}, ans152{0}, }, diff --git a/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go b/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go index 43d3cde8..b6dce5e4 100644 --- a/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go +++ b/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go @@ -26,42 +26,42 @@ func Test_Problem153(t *testing.T) { qs := []question153{ - question153{ + { para153{[]int{5, 1, 2, 3, 4}}, ans153{1}, }, - question153{ + { para153{[]int{1}}, ans153{1}, }, - question153{ + { para153{[]int{1, 2}}, ans153{1}, }, - question153{ + { para153{[]int{2, 1}}, ans153{1}, }, - question153{ + { para153{[]int{2, 3, 1}}, ans153{1}, }, - question153{ + { para153{[]int{1, 2, 3}}, ans153{1}, }, - question153{ + { para153{[]int{3, 4, 5, 1, 2}}, ans153{1}, }, - question153{ + { para153{[]int{4, 5, 6, 7, 0, 1, 2}}, ans153{0}, }, diff --git a/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II_test.go b/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II_test.go index 7cfada0e..8e329a8a 100644 --- a/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II_test.go +++ b/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II_test.go @@ -26,57 +26,57 @@ func Test_Problem154(t *testing.T) { qs := []question154{ - question154{ + { para154{[]int{10, 2, 10, 10, 10, 10}}, ans154{2}, }, - question154{ + { para154{[]int{1, 1}}, ans154{1}, }, - question154{ + { para154{[]int{2, 2, 2, 0, 1}}, ans154{0}, }, - question154{ + { para154{[]int{5, 1, 2, 3, 4}}, ans154{1}, }, - question154{ + { para154{[]int{1}}, ans154{1}, }, - question154{ + { para154{[]int{1, 2}}, ans154{1}, }, - question154{ + { para154{[]int{2, 1}}, ans154{1}, }, - question154{ + { para154{[]int{2, 3, 1}}, ans154{1}, }, - question154{ + { para154{[]int{1, 2, 3}}, ans154{1}, }, - question154{ + { para154{[]int{3, 4, 5, 1, 2}}, ans154{1}, }, - question154{ + { para154{[]int{4, 5, 6, 7, 0, 1, 2}}, ans154{0}, }, diff --git a/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists_test.go b/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists_test.go index e24c710c..cc78f05a 100644 --- a/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists_test.go +++ b/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists_test.go @@ -29,32 +29,32 @@ func Test_Problem160(t *testing.T) { qs := []question160{ - question160{ + { para160{[]int{}, []int{}}, ans160{[]int{}}, }, - question160{ + { para160{[]int{3}, []int{1, 2, 3}}, ans160{[]int{3}}, }, - question160{ + { para160{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans160{[]int{1, 2, 3, 4}}, }, - question160{ + { para160{[]int{4, 1, 8, 4, 5}, []int{5, 0, 1, 8, 4, 5}}, ans160{[]int{8, 4, 5}}, }, - question160{ + { para160{[]int{1}, []int{9, 9, 9, 9, 9}}, ans160{[]int{}}, }, - question160{ + { para160{[]int{0, 9, 1, 2, 4}, []int{3, 2, 4}}, ans160{[]int{2, 4}}, }, diff --git a/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go b/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go index f5ef72bb..d446b33d 100644 --- a/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go +++ b/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go @@ -26,37 +26,37 @@ func Test_Problem162(t *testing.T) { qs := []question162{ - question162{ + { para162{[]int{2, 1, 2}}, ans162{0}, }, - question162{ + { para162{[]int{3, 2, 1}}, ans162{0}, }, - question162{ + { para162{[]int{1, 2}}, ans162{1}, }, - question162{ + { para162{[]int{2, 1}}, ans162{0}, }, - question162{ + { para162{[]int{1}}, ans162{0}, }, - question162{ + { para162{[]int{1, 2, 3, 1}}, ans162{2}, }, - question162{ + { para162{[]int{1, 2, 1, 3, 5, 6, 4}}, ans162{5}, }, diff --git a/leetcode/0164.Maximum-Gap/164. Maximum Gap_test.go b/leetcode/0164.Maximum-Gap/164. Maximum Gap_test.go index cb203d87..6030dfe2 100644 --- a/leetcode/0164.Maximum-Gap/164. Maximum Gap_test.go +++ b/leetcode/0164.Maximum-Gap/164. Maximum Gap_test.go @@ -26,26 +26,26 @@ func Test_Problem164(t *testing.T) { qs := []question164{ - question164{ + { para164{[]int{3, 6, 9, 1}}, ans164{3}, }, - question164{ + { para164{[]int{1}}, ans164{0}, }, - question164{ + { para164{[]int{}}, ans164{0}, }, - question164{ + { para164{[]int{2, 10}}, ans164{8}, }, - question164{ + { para164{[]int{2, 435, 214, 64321, 643, 7234, 7, 436523, 7856, 8}}, ans164{372202}, }, diff --git a/leetcode/0167.Two-Sum-II---Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go b/leetcode/0167.Two-Sum-II---Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go index e7336806..c172641a 100644 --- a/leetcode/0167.Two-Sum-II---Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go +++ b/leetcode/0167.Two-Sum-II---Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go @@ -27,7 +27,7 @@ func Test_Problem167(t *testing.T) { qs := []question167{ - question167{ + { para167{[]int{2, 7, 11, 15}, 9}, ans167{[]int{1, 2}}, }, diff --git a/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title_test.go b/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title_test.go index 7b9ef119..b0a6b4d8 100644 --- a/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title_test.go +++ b/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title_test.go @@ -26,32 +26,32 @@ func Test_Problem168(t *testing.T) { qs := []question168{ - question168{ + { para168{1}, ans168{"A"}, }, - question168{ + { para168{28}, ans168{"AB"}, }, - question168{ + { para168{701}, ans168{"ZY"}, }, - question168{ + { para168{10011}, ans168{"NUA"}, }, - question168{ + { para168{999}, ans168{"ALK"}, }, - question168{ + { para168{681}, ans168{"ZE"}, }, diff --git a/leetcode/0169.Majority-Element/169. Majority Element_test.go b/leetcode/0169.Majority-Element/169. Majority Element_test.go index 08c9bb89..a6aa6dc4 100644 --- a/leetcode/0169.Majority-Element/169. Majority Element_test.go +++ b/leetcode/0169.Majority-Element/169. Majority Element_test.go @@ -26,22 +26,22 @@ func Test_Problem169(t *testing.T) { qs := []question169{ - question169{ + { para169{[]int{2, 2, 1}}, ans169{2}, }, - question169{ + { para169{[]int{3, 2, 3}}, ans169{3}, }, - question169{ + { para169{[]int{2, 2, 1, 1, 1, 2, 2}}, ans169{2}, }, - question169{ + { para169{[]int{-2147483648}}, ans169{-2147483648}, }, diff --git a/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number_test.go b/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number_test.go index 955b4701..1b75d1ad 100644 --- a/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number_test.go +++ b/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number_test.go @@ -26,22 +26,22 @@ func Test_Problem171(t *testing.T) { qs := []question171{ - question171{ + { para171{"A"}, ans171{1}, }, - question171{ + { para171{"AB"}, ans171{28}, }, - question171{ + { para171{"ZY"}, ans171{701}, }, - question171{ + { para171{"ABC"}, ans171{731}, }, diff --git a/leetcode/0172.Factorial-Trailing-Zeroes/172. Factorial Trailing Zeroes_test.go b/leetcode/0172.Factorial-Trailing-Zeroes/172. Factorial Trailing Zeroes_test.go index a51a3a18..c29815fc 100644 --- a/leetcode/0172.Factorial-Trailing-Zeroes/172. Factorial Trailing Zeroes_test.go +++ b/leetcode/0172.Factorial-Trailing-Zeroes/172. Factorial Trailing Zeroes_test.go @@ -26,12 +26,12 @@ func Test_Problem172(t *testing.T) { qs := []question172{ - question172{ + { para172{3}, ans172{0}, }, - question172{ + { para172{5}, ans172{1}, }, diff --git a/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go b/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go index baa06fcb..fb2515c6 100644 --- a/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go +++ b/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go @@ -26,23 +26,23 @@ func Test_Problem174(t *testing.T) { qs := []question174{ - question174{ - para174{[][]int{[]int{2, 1}, []int{1, -1}}}, + { + para174{[][]int{{2, 1}, {1, -1}}}, ans174{1}, }, - question174{ - para174{[][]int{[]int{-3, 5}}}, + { + para174{[][]int{{-3, 5}}}, ans174{4}, }, - question174{ - para174{[][]int{[]int{100}}}, + { + para174{[][]int{{100}}}, ans174{1}, }, - question174{ - para174{[][]int{[]int{-2, -3, 3}, []int{-5, -10, 1}, []int{10, 30, -5}}}, + { + para174{[][]int{{-2, -3, 3}, {-5, -10, 1}, {10, 30, -5}}}, ans174{7}, }, } diff --git a/leetcode/0179.Largest-Number/179. Largest Number_test.go b/leetcode/0179.Largest-Number/179. Largest Number_test.go index 3b40b312..20d98c3d 100644 --- a/leetcode/0179.Largest-Number/179. Largest Number_test.go +++ b/leetcode/0179.Largest-Number/179. Largest Number_test.go @@ -26,46 +26,46 @@ func Test_Problem179(t *testing.T) { qs := []question179{ - question179{ + { para179{[]int{3, 6, 9, 1}}, ans179{"9631"}, }, - question179{ + { para179{[]int{1}}, ans179{"1"}, }, - question179{ + { para179{[]int{}}, ans179{""}, }, - question179{ + { para179{[]int{2, 10}}, ans179{"210"}, }, - question179{ + { para179{[]int{3, 30, 34, 5, 9}}, ans179{"9534330"}, }, - question179{ + { para179{[]int{12, 128}}, ans179{"12812"}, }, - question179{ + { para179{[]int{12, 121}}, ans179{"12121"}, }, - question179{ + { para179{[]int{0, 0}}, ans179{"0"}, }, - question179{ + { para179{[]int{1440, 7548, 4240, 6616, 733, 4712, 883, 8, 9576}}, ans179{"9576888375487336616471242401440"}, }, diff --git a/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go b/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go index 7d78d0e7..ae0e40c9 100644 --- a/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go +++ b/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go @@ -26,7 +26,7 @@ func Test_Problem187(t *testing.T) { qs := []question187{ - question187{ + { para187{"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"}, ans187{[]string{"AAAAACCCCC", "CCCCCAAAAA"}}, }, diff --git a/leetcode/0190.Reverse-Bits/190. Reverse Bits_test.go b/leetcode/0190.Reverse-Bits/190. Reverse Bits_test.go index 637d65e7..20c677d6 100644 --- a/leetcode/0190.Reverse-Bits/190. Reverse Bits_test.go +++ b/leetcode/0190.Reverse-Bits/190. Reverse Bits_test.go @@ -26,12 +26,12 @@ func Test_Problem190(t *testing.T) { qs := []question190{ - question190{ + { para190{43261596}, ans190{964176192}, }, - question190{ + { para190{4294967293}, ans190{3221225471}, }, diff --git a/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits_test.go b/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits_test.go index be7ff715..f327977c 100644 --- a/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits_test.go +++ b/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits_test.go @@ -26,11 +26,11 @@ func Test_Problem191(t *testing.T) { qs := []question191{ - question191{ + { para191{5}, ans191{1}, }, - question191{ + { para191{13}, ans191{2}, }, diff --git a/leetcode/0198.House-Robber/198. House Robber_test.go b/leetcode/0198.House-Robber/198. House Robber_test.go index e2f9be99..95eb40ff 100644 --- a/leetcode/0198.House-Robber/198. House Robber_test.go +++ b/leetcode/0198.House-Robber/198. House Robber_test.go @@ -26,16 +26,16 @@ func Test_Problem198(t *testing.T) { qs := []question198{ - question198{ + { para198{[]int{1, 2}}, ans198{2}, }, - question198{ + { para198{[]int{1, 2, 3, 1}}, ans198{4}, }, - question198{ + { para198{[]int{2, 7, 9, 3, 1}}, ans198{12}, }, diff --git a/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View_test.go b/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View_test.go index 0f8b6e68..58265fef 100644 --- a/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View_test.go +++ b/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View_test.go @@ -28,22 +28,22 @@ func Test_Problem199(t *testing.T) { qs := []question199{ - question199{ + { para199{[]int{}}, ans199{[]int{}}, }, - question199{ + { para199{[]int{1}}, ans199{[]int{1}}, }, - question199{ + { para199{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans199{[]int{3, 20, 7}}, }, - question199{ + { para199{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, 5}}, ans199{[]int{1, 3, 5}}, }, diff --git a/leetcode/0200.Number-of-Islands/200. Number of Islands.go b/leetcode/0200.Number-of-Islands/200. Number of Islands.go index dac864a5..79829e07 100644 --- a/leetcode/0200.Number-of-Islands/200. Number of Islands.go +++ b/leetcode/0200.Number-of-Islands/200. Number of Islands.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func numIslands(grid [][]byte) int { diff --git a/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go b/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go index 3f7805d8..8c16ac76 100644 --- a/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go +++ b/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go @@ -26,22 +26,22 @@ func Test_Problem200(t *testing.T) { qs := []question200{ - question200{ + { para200{[][]byte{ - []byte{'1', '1', '1', '1', '0'}, - []byte{'1', '1', '0', '1', '0'}, - []byte{'1', '1', '0', '0', '0'}, - []byte{'0', '0', '0', '0', '0'}, + {'1', '1', '1', '1', '0'}, + {'1', '1', '0', '1', '0'}, + {'1', '1', '0', '0', '0'}, + {'0', '0', '0', '0', '0'}, }}, ans200{1}, }, - question200{ + { para200{[][]byte{ - []byte{'1', '1', '0', '0', '0'}, - []byte{'1', '1', '0', '0', '0'}, - []byte{'0', '0', '1', '0', '0'}, - []byte{'0', '0', '0', '1', '1'}, + {'1', '1', '0', '0', '0'}, + {'1', '1', '0', '0', '0'}, + {'0', '0', '1', '0', '0'}, + {'0', '0', '0', '1', '1'}, }}, ans200{3}, }, diff --git a/leetcode/0201.Bitwise-AND-of-Numbers-Range/201. Bitwise AND of Numbers Range_test.go b/leetcode/0201.Bitwise-AND-of-Numbers-Range/201. Bitwise AND of Numbers Range_test.go index d68684cd..047214a0 100644 --- a/leetcode/0201.Bitwise-AND-of-Numbers-Range/201. Bitwise AND of Numbers Range_test.go +++ b/leetcode/0201.Bitwise-AND-of-Numbers-Range/201. Bitwise AND of Numbers Range_test.go @@ -27,12 +27,12 @@ func Test_Problem201(t *testing.T) { qs := []question201{ - question201{ + { para201{5, 7}, ans201{4}, }, - question201{ + { para201{0, 1}, ans201{0}, }, diff --git a/leetcode/0202.Happy-Number/202. Happy Number_test.go b/leetcode/0202.Happy-Number/202. Happy Number_test.go index f4963e98..d8e4e7f9 100644 --- a/leetcode/0202.Happy-Number/202. Happy Number_test.go +++ b/leetcode/0202.Happy-Number/202. Happy Number_test.go @@ -26,12 +26,12 @@ func Test_Problem202(t *testing.T) { qs := []question202{ - question202{ + { para202{202}, ans202{false}, }, - question202{ + { para202{19}, ans202{true}, }, diff --git a/leetcode/0203.Remove-Linked-List-Elements/203. Remove Linked List Elements_test.go b/leetcode/0203.Remove-Linked-List-Elements/203. Remove Linked List Elements_test.go index fe020fb6..f673d276 100644 --- a/leetcode/0203.Remove-Linked-List-Elements/203. Remove Linked List Elements_test.go +++ b/leetcode/0203.Remove-Linked-List-Elements/203. Remove Linked List Elements_test.go @@ -29,42 +29,42 @@ func Test_Problem203(t *testing.T) { qs := []question203{ - question203{ + { para203{[]int{1, 2, 3, 4, 5}, 1}, ans203{[]int{2, 3, 4, 5}}, }, - question203{ + { para203{[]int{1, 2, 3, 4, 5}, 2}, ans203{[]int{1, 3, 4, 5}}, }, - question203{ + { para203{[]int{1, 1, 1, 1, 1}, 1}, ans203{[]int{}}, }, - question203{ + { para203{[]int{1, 2, 3, 2, 3, 2, 3, 2}, 2}, ans203{[]int{1, 3, 3, 3}}, }, - question203{ + { para203{[]int{1, 2, 3, 4, 5}, 5}, ans203{[]int{1, 2, 3, 4}}, }, - question203{ + { para203{[]int{}, 5}, ans203{[]int{}}, }, - question203{ + { para203{[]int{1, 2, 3, 4, 5}, 10}, ans203{[]int{1, 2, 3, 4, 5}}, }, - question203{ + { para203{[]int{1}, 1}, ans203{[]int{}}, }, diff --git a/leetcode/0204.Count-Primes/204. Count Primes_test.go b/leetcode/0204.Count-Primes/204. Count Primes_test.go index b5c2cc89..884e9db4 100644 --- a/leetcode/0204.Count-Primes/204. Count Primes_test.go +++ b/leetcode/0204.Count-Primes/204. Count Primes_test.go @@ -26,17 +26,17 @@ func Test_Problem204(t *testing.T) { qs := []question204{ - question204{ + { para204{10}, ans204{4}, }, - question204{ + { para204{100}, ans204{25}, }, - question204{ + { para204{1000}, ans204{168}, }, diff --git a/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go b/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go index a8913622..d18c1f43 100644 --- a/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go +++ b/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go @@ -27,22 +27,22 @@ func Test_Problem205(t *testing.T) { qs := []question205{ - question205{ + { para205{"egg", "add"}, ans205{true}, }, - question205{ + { para205{"foo", "bar"}, ans205{false}, }, - question205{ + { para205{"paper", "title"}, ans205{true}, }, - question205{ + { para205{"", ""}, ans205{true}, }, diff --git a/leetcode/0206.Reverse-Linked-List/206. Reverse Linked List_test.go b/leetcode/0206.Reverse-Linked-List/206. Reverse Linked List_test.go index 109406a7..08e78a46 100644 --- a/leetcode/0206.Reverse-Linked-List/206. Reverse Linked List_test.go +++ b/leetcode/0206.Reverse-Linked-List/206. Reverse Linked List_test.go @@ -28,7 +28,7 @@ func Test_Problem206(t *testing.T) { qs := []question206{ - question206{ + { para206{[]int{1, 2, 3, 4, 5}}, ans206{[]int{5, 4, 3, 2, 1}}, }, diff --git a/leetcode/0207.Course-Schedule/207. Course Schedule_test.go b/leetcode/0207.Course-Schedule/207. Course Schedule_test.go index e1d79a0c..0f5395dd 100644 --- a/leetcode/0207.Course-Schedule/207. Course Schedule_test.go +++ b/leetcode/0207.Course-Schedule/207. Course Schedule_test.go @@ -27,13 +27,13 @@ func Test_Problem207(t *testing.T) { qs := []question207{ - question207{ - para207{2, [][]int{[]int{1, 0}}}, + { + para207{2, [][]int{{1, 0}}}, ans207{true}, }, - question207{ - para207{2, [][]int{[]int{1, 0}, []int{0, 1}}}, + { + para207{2, [][]int{{1, 0}, {0, 1}}}, ans207{false}, }, } diff --git a/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go b/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go index 0bc0537e..446b943d 100644 --- a/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go +++ b/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go @@ -27,7 +27,7 @@ func Test_Problem209(t *testing.T) { qs := []question209{ - question209{ + { para209{7, []int{2, 3, 1, 2, 4, 3}}, ans209{2}, }, diff --git a/leetcode/0210.Course-Schedule-II/210. Course Schedule II_test.go b/leetcode/0210.Course-Schedule-II/210. Course Schedule II_test.go index 6e75c853..871bfc6e 100644 --- a/leetcode/0210.Course-Schedule-II/210. Course Schedule II_test.go +++ b/leetcode/0210.Course-Schedule-II/210. Course Schedule II_test.go @@ -27,23 +27,23 @@ func Test_Problem210(t *testing.T) { qs := []question210{ - question210{ - para210{2, [][]int{[]int{1, 0}}}, + { + para210{2, [][]int{{1, 0}}}, ans210{[]int{0, 1}}, }, - question210{ - para210{2, [][]int{[]int{1, 0}, []int{0, 1}}}, + { + para210{2, [][]int{{1, 0}, {0, 1}}}, ans210{[]int{0, 1, 2, 3}}, }, - question210{ - para210{4, [][]int{[]int{1, 0}, []int{2, 0}, []int{3, 1}, []int{3, 2}}}, + { + para210{4, [][]int{{1, 0}, {2, 0}, {3, 1}, {3, 2}}}, ans210{[]int{0, 1, 2, 3}}, }, - question210{ - para210{3, [][]int{[]int{1, 0}, []int{1, 2}, []int{0, 1}}}, + { + para210{3, [][]int{{1, 0}, {1, 2}, {0, 1}}}, ans210{[]int{}}, }, } diff --git a/leetcode/0212.Word-Search-II/212. Word Search II.go b/leetcode/0212.Word-Search-II/212. Word Search II.go index e8f1da01..bea7241a 100644 --- a/leetcode/0212.Word-Search-II/212. Word Search II.go +++ b/leetcode/0212.Word-Search-II/212. Word Search II.go @@ -12,10 +12,10 @@ func findWords(board [][]byte, words []string) []string { // these is 79 solution var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func exist(board [][]byte, word string) bool { diff --git a/leetcode/0212.Word-Search-II/212. Word Search II_test.go b/leetcode/0212.Word-Search-II/212. Word Search II_test.go index 9bcf342b..36780401 100644 --- a/leetcode/0212.Word-Search-II/212. Word Search II_test.go +++ b/leetcode/0212.Word-Search-II/212. Word Search II_test.go @@ -27,21 +27,21 @@ func Test_Problem212(t *testing.T) { qs := []question212{ - question212{ + { para212{[][]byte{ - []byte{'A', 'B', 'C', 'E'}, - []byte{'S', 'F', 'C', 'S'}, - []byte{'A', 'D', 'E', 'E'}, + {'A', 'B', 'C', 'E'}, + {'S', 'F', 'C', 'S'}, + {'A', 'D', 'E', 'E'}, }, []string{"ABCCED", "SEE", "ABCB"}}, ans212{[]string{"ABCCED", "SEE"}}, }, - question212{ + { para212{[][]byte{ - []byte{'o', 'a', 'a', 'n'}, - []byte{'e', 't', 'a', 'e'}, - []byte{'i', 'h', 'k', 'r'}, - []byte{'i', 'f', 'l', 'v'}, + {'o', 'a', 'a', 'n'}, + {'e', 't', 'a', 'e'}, + {'i', 'h', 'k', 'r'}, + {'i', 'f', 'l', 'v'}, }, []string{"oath", "pea", "eat", "rain"}}, ans212{[]string{"oath", "eat"}}, }, diff --git a/leetcode/0213.House-Robber-II/213. House Robber II_test.go b/leetcode/0213.House-Robber-II/213. House Robber II_test.go index c2faf927..9c09e9e4 100644 --- a/leetcode/0213.House-Robber-II/213. House Robber II_test.go +++ b/leetcode/0213.House-Robber-II/213. House Robber II_test.go @@ -26,16 +26,16 @@ func Test_Problem213(t *testing.T) { qs := []question213{ - question213{ + { para213{[]int{0, 0}}, ans213{0}, }, - question213{ + { para213{[]int{2, 3, 2}}, ans213{3}, }, - question213{ + { para213{[]int{1, 2, 3, 1}}, ans213{4}, }, diff --git a/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array_test.go b/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array_test.go index e66bb953..0eef94c4 100644 --- a/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array_test.go +++ b/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array_test.go @@ -27,27 +27,27 @@ func Test_Problem215(t *testing.T) { qs := []question215{ - question215{ + { para215{[]int{3, 2, 1, 5, 6, 4}, 2}, ans215{5}, }, - question215{ + { para215{[]int{3, 2, 3, 1, 2, 4, 5, 5, 6}, 4}, ans215{4}, }, - question215{ + { para215{[]int{0, 0, 0, 0, 0}, 2}, ans215{0}, }, - question215{ + { para215{[]int{1}, 1}, ans215{1}, }, - question215{ + { para215{[]int{3, 2, 3, 1, 2, 4, 5, 5, 6, 7, 7, 8, 2, 3, 1, 1, 1, 10, 11, 5, 6, 2, 4, 7, 8, 5, 6}, 20}, ans215{2}, }, diff --git a/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go b/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go index b5891597..c4bcaad6 100644 --- a/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go +++ b/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go @@ -27,13 +27,13 @@ func Test_Problem216(t *testing.T) { qs := []question216{ - question216{ + { para216{3, 7}, - ans216{[][]int{[]int{1, 2, 4}}}, + ans216{[][]int{{1, 2, 4}}}, }, - question216{ + { para216{3, 9}, - ans216{[][]int{[]int{1, 2, 6}, []int{1, 3, 5}, []int{2, 3, 4}}}, + ans216{[][]int{{1, 2, 6}, {1, 3, 5}, {2, 3, 4}}}, }, } diff --git a/leetcode/0217.Contains-Duplicate/217. Contains Duplicate_test.go b/leetcode/0217.Contains-Duplicate/217. Contains Duplicate_test.go index 270d0041..32542d57 100644 --- a/leetcode/0217.Contains-Duplicate/217. Contains Duplicate_test.go +++ b/leetcode/0217.Contains-Duplicate/217. Contains Duplicate_test.go @@ -26,17 +26,17 @@ func Test_Problem217(t *testing.T) { qs := []question217{ - question217{ + { para217{[]int{1, 2, 3, 1}}, ans217{true}, }, - question217{ + { para217{[]int{1, 2, 3, 4}}, ans217{false}, }, - question217{ + { para217{[]int{1, 1, 1, 3, 3, 4, 3, 2, 4, 2}}, ans217{true}, }, diff --git a/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go b/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go index f51b3364..3c861287 100644 --- a/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go +++ b/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go @@ -26,9 +26,9 @@ func Test_Problem218(t *testing.T) { qs := []question218{ - question218{ - para218{[][]int{[]int{2, 9, 10}, []int{3, 7, 15}, []int{5, 12, 12}, []int{15, 20, 10}, []int{19, 24, 8}}}, - ans218{[][]int{[]int{2, 10}, []int{3, 15}, []int{7, 12}, []int{12, 0}, []int{15, 10}, []int{20, 8}, []int{24, 0}}}, + { + para218{[][]int{{2, 9, 10}, {3, 7, 15}, {5, 12, 12}, {15, 20, 10}, {19, 24, 8}}}, + ans218{[][]int{{2, 10}, {3, 15}, {7, 12}, {12, 0}, {15, 10}, {20, 8}, {24, 0}}}, }, } diff --git a/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go b/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go index e666345b..39bb6a6c 100644 --- a/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go +++ b/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go @@ -27,17 +27,17 @@ func Test_Problem219(t *testing.T) { qs := []question219{ - question219{ + { para219{[]int{1, 2, 3, 1}, 3}, ans219{true}, }, - question219{ + { para219{[]int{1, 0, 0, 1}, 1}, ans219{true}, }, - question219{ + { para219{[]int{1, 2, 3, 1, 2, 3}, 2}, ans219{false}, }, diff --git a/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go b/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go index 18761e0d..c5ef7906 100644 --- a/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go +++ b/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go @@ -28,27 +28,27 @@ func Test_Problem220(t *testing.T) { qs := []question220{ - question220{ + { para220{[]int{7, 1, 3}, 2, 3}, ans220{true}, }, - question220{ + { para220{[]int{-1, -1}, 1, -1}, ans220{false}, }, - question220{ + { para220{[]int{1, 2, 3, 1}, 3, 0}, ans220{true}, }, - question220{ + { para220{[]int{1, 0, 1, 1}, 1, 2}, ans220{true}, }, - question220{ + { para220{[]int{1, 5, 9, 1, 5, 9}, 2, 3}, ans220{false}, }, diff --git a/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes_test.go b/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes_test.go index 54a3819f..2c7b8b8e 100644 --- a/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes_test.go +++ b/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes_test.go @@ -28,22 +28,22 @@ func Test_Problem222(t *testing.T) { qs := []question222{ - question222{ + { para222{[]int{}}, ans222{0}, }, - question222{ + { para222{[]int{1}}, ans222{1}, }, - question222{ + { para222{[]int{1, 2, 3}}, ans222{3}, }, - question222{ + { para222{[]int{1, 2, 3, 4, 5, 6}}, ans222{6}, }, diff --git a/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go b/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go index c7f8c7b9..5b092d78 100644 --- a/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go +++ b/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go @@ -33,7 +33,7 @@ func Test_Problem223(t *testing.T) { qs := []question223{ - question223{ + { para223{-3, 0, 3, 4, 0, -1, 9, 2}, ans223{45}, }, diff --git a/leetcode/0224.Basic-Calculator/224. Basic Calculator.go b/leetcode/0224.Basic-Calculator/224. Basic Calculator.go index 0804a1b4..29400c92 100644 --- a/leetcode/0224.Basic-Calculator/224. Basic Calculator.go +++ b/leetcode/0224.Basic-Calculator/224. Basic Calculator.go @@ -53,7 +53,7 @@ func calculate1(s string) int { break } } - tmp = string(stack[index+1 : len(stack)]) + tmp = string(stack[index+1:]) stack = stack[:index] res := strconv.Itoa(calculateStr(tmp)) for j := 0; j < len(res); j++ { @@ -98,7 +98,6 @@ func calculateStr(str string) int { if tmpStr != "" { num, _ := strconv.Atoi(tmpStr) nums = append(nums, num) - tmpStr = "" } res = nums[0] for i := 0; i < len(s); i++ { diff --git a/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go b/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go index 35e7b067..47331a69 100644 --- a/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go +++ b/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go @@ -26,21 +26,21 @@ func Test_Problem224(t *testing.T) { qs := []question224{ - question224{ + { para224{"1 + 1"}, ans224{2}, }, - question224{ + { para224{" 2-1 + 2 "}, ans224{3}, }, - question224{ + { para224{"(1+(4+5+2)-3)+(6+8)"}, ans224{23}, }, - question224{ + { para224{"2-(5-6)"}, ans224{3}, }, diff --git a/leetcode/0226.Invert-Binary-Tree/226. Invert Binary Tree_test.go b/leetcode/0226.Invert-Binary-Tree/226. Invert Binary Tree_test.go index 9e808b8d..9fde95dd 100644 --- a/leetcode/0226.Invert-Binary-Tree/226. Invert Binary Tree_test.go +++ b/leetcode/0226.Invert-Binary-Tree/226. Invert Binary Tree_test.go @@ -28,17 +28,17 @@ func Test_Problem226(t *testing.T) { qs := []question226{ - question226{ + { para226{[]int{}}, ans226{[]int{}}, }, - question226{ + { para226{[]int{1}}, ans226{[]int{1}}, }, - question226{ + { para226{[]int{4, 2, 7, 1, 3, 6, 9}}, ans226{[]int{4, 7, 2, 9, 6, 3, 1}}, }, diff --git a/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go b/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go index 2eb99c51..2450ae50 100644 --- a/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go +++ b/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go @@ -26,12 +26,12 @@ func Test_Problem229(t *testing.T) { qs := []question229{ - question229{ + { para229{[]int{3, 2, 3}}, ans229{[]int{3}}, }, - question229{ + { para229{[]int{1, 1, 1, 3, 3, 2, 2, 2}}, ans229{[]int{1, 2}}, }, diff --git a/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST_test.go b/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST_test.go index 3c5d52fd..4eb806ff 100644 --- a/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST_test.go +++ b/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST_test.go @@ -29,17 +29,17 @@ func Test_Problem230(t *testing.T) { qs := []question230{ - question230{ + { para230{[]int{}, 0}, ans230{0}, }, - question230{ + { para230{[]int{3, 1, 4, structures.NULL, 2}, 1}, ans230{1}, }, - question230{ + { para230{[]int{5, 3, 6, 2, 4, structures.NULL, structures.NULL, 1}, 3}, ans230{3}, }, diff --git a/leetcode/0231.Power-of-Two/231. Power of Two_test.go b/leetcode/0231.Power-of-Two/231. Power of Two_test.go index 5566b017..15b9681f 100644 --- a/leetcode/0231.Power-of-Two/231. Power of Two_test.go +++ b/leetcode/0231.Power-of-Two/231. Power of Two_test.go @@ -26,17 +26,17 @@ func Test_Problem231(t *testing.T) { qs := []question231{ - question231{ + { para231{1}, ans231{true}, }, - question231{ + { para231{16}, ans231{true}, }, - question231{ + { para231{218}, ans231{false}, }, diff --git a/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go b/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go index 74b0592c..8fd7a31a 100644 --- a/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go +++ b/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go @@ -28,52 +28,52 @@ func Test_Problem234(t *testing.T) { qs := []question234{ - question234{ + { para234{[]int{1, 1, 2, 2, 3, 4, 4, 4}}, ans234{false}, }, - question234{ + { para234{[]int{1, 1, 1, 1, 1, 1}}, ans234{true}, }, - question234{ + { para234{[]int{1, 2, 2, 1, 3}}, ans234{false}, }, - question234{ + { para234{[]int{1}}, ans234{true}, }, - question234{ + { para234{[]int{}}, ans234{true}, }, - question234{ + { para234{[]int{1, 2, 2, 2, 2, 1}}, ans234{true}, }, - question234{ + { para234{[]int{1, 2, 2, 3, 3, 3, 3, 2, 2, 1}}, ans234{true}, }, - question234{ + { para234{[]int{1, 2}}, ans234{false}, }, - question234{ + { para234{[]int{1, 0, 1}}, ans234{true}, }, - question234{ + { para234{[]int{1, 1, 2, 1}}, ans234{false}, }, diff --git a/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go b/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go index a42c7012..675dddc1 100644 --- a/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go +++ b/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go @@ -30,17 +30,17 @@ func Test_Problem235(t *testing.T) { qs := []question235{ - question235{ + { para235{[]int{}, []int{}, []int{}}, ans235{[]int{}}, }, - question235{ + { para235{[]int{6, 2, 8, 0, 4, 7, 9, structures.NULL, structures.NULL, 3, 5}, []int{2}, []int{8}}, ans235{[]int{6}}, }, - question235{ + { para235{[]int{6, 2, 8, 0, 4, 7, 9, structures.NULL, structures.NULL, 3, 5}, []int{2}, []int{4}}, ans235{[]int{2}}, }, diff --git a/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go b/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go index eae15919..48a471f4 100644 --- a/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go +++ b/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go @@ -30,27 +30,27 @@ func Test_Problem236(t *testing.T) { qs := []question236{ - question236{ + { para236{[]int{}, []int{}, []int{}}, ans236{[]int{}}, }, - question236{ + { para236{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, []int{5}, []int{1}}, ans236{[]int{3}}, }, - question236{ + { para236{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, []int{5}, []int{4}}, ans236{[]int{5}}, }, - question236{ + { para236{[]int{6, 2, 8, 0, 4, 7, 9, structures.NULL, structures.NULL, 3, 5}, []int{2}, []int{8}}, ans236{[]int{6}}, }, - question236{ + { para236{[]int{6, 2, 8, 0, 4, 7, 9, structures.NULL, structures.NULL, 3, 5}, []int{2}, []int{4}}, ans236{[]int{2}}, }, diff --git a/leetcode/0237.Delete-Node-in-a-Linked-List/237. Delete Node in a Linked List_test.go b/leetcode/0237.Delete-Node-in-a-Linked-List/237. Delete Node in a Linked List_test.go index 81c370e8..29e43c34 100644 --- a/leetcode/0237.Delete-Node-in-a-Linked-List/237. Delete Node in a Linked List_test.go +++ b/leetcode/0237.Delete-Node-in-a-Linked-List/237. Delete Node in a Linked List_test.go @@ -29,37 +29,37 @@ func Test_Problem237(t *testing.T) { qs := []question237{ - question237{ + { para237{[]int{1, 2, 3, 4, 5}, 1}, ans237{[]int{2, 3, 4, 5}}, }, - question237{ + { para237{[]int{1, 2, 3, 4, 5}, 2}, ans237{[]int{1, 3, 4, 5}}, }, - question237{ + { para237{[]int{1, 1, 1, 1, 1}, 1}, ans237{[]int{}}, }, - question237{ + { para237{[]int{1, 2, 3, 4, 5}, 5}, ans237{[]int{1, 2, 3, 4}}, }, - question237{ + { para237{[]int{}, 5}, ans237{[]int{}}, }, - question237{ + { para237{[]int{1, 2, 3, 4, 5}, 10}, ans237{[]int{1, 2, 3, 4, 5}}, }, - question237{ + { para237{[]int{1}, 1}, ans237{[]int{}}, }, diff --git a/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go b/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go index 5b0425eb..805ea08b 100644 --- a/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go +++ b/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go @@ -29,7 +29,7 @@ func maxSlidingWindow(nums []int, k int) []int { result := make([]int, 0, len(nums)-k+1) for i, v := range nums { // if the left-most index is out of window, remove it if i >= k && window[0] <= i-k { - window = window[1:len(window)] + window = window[1:] } for len(window) > 0 && nums[window[len(window)-1]] < v { // maintain window window = window[0 : len(window)-1] diff --git a/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go b/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go index ce348a42..a8e54298 100644 --- a/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go +++ b/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go @@ -27,7 +27,7 @@ func Test_Problem239(t *testing.T) { qs := []question239{ - question239{ + { para239{[]int{1, 3, -1, -3, 5, 3, 6, 7}, 3}, ans239{[]int{3, 3, 5, 5, 6, 7}}, }, diff --git a/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go b/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go index 22e5efe6..e8a3d915 100644 --- a/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go +++ b/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go @@ -27,13 +27,13 @@ func Test_Problem240(t *testing.T) { qs := []question240{ - question240{ - para240{[][]int{[]int{1, 4, 7, 11, 15}, []int{2, 5, 8, 12, 19}, []int{3, 6, 9, 16, 22}, []int{10, 13, 14, 17, 24}, []int{18, 21, 23, 26, 30}}, 5}, + { + para240{[][]int{{1, 4, 7, 11, 15}, {2, 5, 8, 12, 19}, {3, 6, 9, 16, 22}, {10, 13, 14, 17, 24}, {18, 21, 23, 26, 30}}, 5}, ans240{true}, }, - question240{ - para240{[][]int{[]int{1, 4, 7, 11, 15}, []int{2, 5, 8, 12, 19}, []int{3, 6, 9, 16, 22}, []int{10, 13, 14, 17, 24}, []int{18, 21, 23, 26, 30}}, 20}, + { + para240{[][]int{{1, 4, 7, 11, 15}, {2, 5, 8, 12, 19}, {3, 6, 9, 16, 22}, {10, 13, 14, 17, 24}, {18, 21, 23, 26, 30}}, 20}, ans240{false}, }, } diff --git a/leetcode/0242.Valid-Anagram/242. Valid Anagram_test.go b/leetcode/0242.Valid-Anagram/242. Valid Anagram_test.go index e9b363fa..15a108ca 100644 --- a/leetcode/0242.Valid-Anagram/242. Valid Anagram_test.go +++ b/leetcode/0242.Valid-Anagram/242. Valid Anagram_test.go @@ -27,21 +27,21 @@ func Test_Problem242(t *testing.T) { qs := []question242{ - question242{ + { para242{"", ""}, ans242{true}, }, - question242{ + { para242{"", "1"}, ans242{false}, }, - question242{ + { para242{"anagram", "nagaram"}, ans242{true}, }, - question242{ + { para242{"rat", "car"}, ans242{false}, }, diff --git a/leetcode/0257.Binary-Tree-Paths/257. Binary Tree Paths_test.go b/leetcode/0257.Binary-Tree-Paths/257. Binary Tree Paths_test.go index cba57aaf..dcea1685 100644 --- a/leetcode/0257.Binary-Tree-Paths/257. Binary Tree Paths_test.go +++ b/leetcode/0257.Binary-Tree-Paths/257. Binary Tree Paths_test.go @@ -28,17 +28,17 @@ func Test_Problem257(t *testing.T) { qs := []question257{ - question257{ + { para257{[]int{}}, ans257{[]string{""}}, }, - question257{ + { para257{[]int{1, 2, 3, structures.NULL, 5, structures.NULL, structures.NULL}}, ans257{[]string{"1->2->5", "1->3"}}, }, - question257{ + { para257{[]int{1, 2, 3, 4, 5, 6, 7}}, ans257{[]string{"1->2->4", "1->2->5", "1->2->4", "1->2->5", "1->3->6", "1->3->7"}}, }, diff --git a/leetcode/0258.Add-Digits/258. Add Digits_test.go b/leetcode/0258.Add-Digits/258. Add Digits_test.go index 78754617..3aed6777 100644 --- a/leetcode/0258.Add-Digits/258. Add Digits_test.go +++ b/leetcode/0258.Add-Digits/258. Add Digits_test.go @@ -26,17 +26,17 @@ func Test_Problem258(t *testing.T) { qs := []question258{ - question258{ + { para258{38}, ans258{2}, }, - question258{ + { para258{88}, ans258{7}, }, - question258{ + { para258{96}, ans258{6}, }, diff --git a/leetcode/0260.Single-Number-III/260. Single Number III_test.go b/leetcode/0260.Single-Number-III/260. Single Number III_test.go index 860605b4..720f4c30 100644 --- a/leetcode/0260.Single-Number-III/260. Single Number III_test.go +++ b/leetcode/0260.Single-Number-III/260. Single Number III_test.go @@ -26,7 +26,7 @@ func Test_Problem260(t *testing.T) { qs := []question260{ - question260{ + { para260{[]int{1, 2, 1, 3, 2, 5}}, ans260{[]int{3, 5}}, }, diff --git a/leetcode/0263.Ugly-Number/263. Ugly Number_test.go b/leetcode/0263.Ugly-Number/263. Ugly Number_test.go index 83a96e00..72ba1385 100644 --- a/leetcode/0263.Ugly-Number/263. Ugly Number_test.go +++ b/leetcode/0263.Ugly-Number/263. Ugly Number_test.go @@ -26,17 +26,17 @@ func Test_Problem263(t *testing.T) { qs := []question263{ - question263{ + { para263{6}, ans263{true}, }, - question263{ + { para263{8}, ans263{true}, }, - question263{ + { para263{14}, ans263{false}, }, diff --git a/leetcode/0268.Missing-Number/268. Missing Number_test.go b/leetcode/0268.Missing-Number/268. Missing Number_test.go index 5997ec6e..a3a7246c 100644 --- a/leetcode/0268.Missing-Number/268. Missing Number_test.go +++ b/leetcode/0268.Missing-Number/268. Missing Number_test.go @@ -26,12 +26,12 @@ func Test_Problem268(t *testing.T) { qs := []question268{ - question268{ + { para268{[]int{3, 0, 1}}, ans268{2}, }, - question268{ + { para268{[]int{9, 6, 4, 2, 3, 5, 7, 0, 1}}, ans268{8}, }, diff --git a/leetcode/0274.H-Index/274. H-Index_test.go b/leetcode/0274.H-Index/274. H-Index_test.go index b302ab8e..35e178da 100644 --- a/leetcode/0274.H-Index/274. H-Index_test.go +++ b/leetcode/0274.H-Index/274. H-Index_test.go @@ -26,21 +26,21 @@ func Test_Problem274(t *testing.T) { qs := []question274{ - question274{ + { para274{[]int{3, 6, 9, 1}}, ans274{3}, }, - question274{ + { para274{[]int{1}}, ans274{1}, }, - question274{ + { para274{[]int{}}, ans274{0}, }, - question274{ + { para274{[]int{3, 0, 6, 1, 5}}, ans274{3}, }, diff --git a/leetcode/0275.H-Index-II/275. H-Index II_test.go b/leetcode/0275.H-Index-II/275. H-Index II_test.go index 87b8a55b..c0ac4e36 100644 --- a/leetcode/0275.H-Index-II/275. H-Index II_test.go +++ b/leetcode/0275.H-Index-II/275. H-Index II_test.go @@ -26,26 +26,26 @@ func Test_Problem275(t *testing.T) { qs := []question275{ - question275{ + { para275{[]int{3, 6, 9, 1}}, ans275{3}, }, - question275{ + { para275{[]int{1}}, ans275{1}, }, - question275{ + { para275{[]int{}}, ans275{0}, }, - question275{ + { para275{[]int{3, 0, 6, 1, 5}}, ans275{3}, }, - question275{ + { para275{[]int{0, 1, 3, 5, 6}}, ans275{3}, }, diff --git a/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go b/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go index 68bc1042..1cc7e531 100644 --- a/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go +++ b/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go @@ -26,32 +26,32 @@ func Test_Problem283(t *testing.T) { qs := []question283{ - question283{ + { para283{[]int{1, 0, 1}}, ans283{[]int{1, 1, 0}}, }, - question283{ + { para283{[]int{0, 1, 0, 3, 0, 12}}, ans283{[]int{1, 3, 12, 0, 0, 0}}, }, - question283{ + { para283{[]int{0, 1, 0, 3, 0, 0, 0, 0, 1, 12}}, ans283{[]int{1, 3, 1, 12, 0, 0, 0, 0, 0}}, }, - question283{ + { para283{[]int{0, 0, 0, 0, 0, 0, 0, 0, 12, 1}}, ans283{[]int{12, 1, 0, 0, 0, 0, 0, 0, 0, 0}}, }, - question283{ + { para283{[]int{0, 0, 0, 0, 0}}, ans283{[]int{0, 0, 0, 0, 0}}, }, - question283{ + { para283{[]int{1}}, ans283{[]int{1}}, }, diff --git a/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go b/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go index 96331f6b..6e4aa1b0 100644 --- a/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go +++ b/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go @@ -26,17 +26,17 @@ func Test_Problem287(t *testing.T) { qs := []question287{ - question287{ + { para287{[]int{1, 3, 4, 2, 2}}, ans287{2}, }, - question287{ + { para287{[]int{3, 1, 3, 4, 2}}, ans287{3}, }, - question287{ + { para287{[]int{2, 2, 2, 2, 2}}, ans287{2}, }, diff --git a/leetcode/0290.Word-Pattern/290. Word Pattern_test.go b/leetcode/0290.Word-Pattern/290. Word Pattern_test.go index c9356501..4997c0ed 100644 --- a/leetcode/0290.Word-Pattern/290. Word Pattern_test.go +++ b/leetcode/0290.Word-Pattern/290. Word Pattern_test.go @@ -27,22 +27,22 @@ func Test_Problem290(t *testing.T) { qs := []question290{ - question290{ + { para290{"abba", "dog cat cat dog"}, ans290{true}, }, - question290{ + { para290{"abba", "dog cat cat fish"}, ans290{false}, }, - question290{ + { para290{"aaaa", "dog cat cat dog"}, ans290{false}, }, - question290{ + { para290{"abba", "dog dog dog dog"}, ans290{false}, }, diff --git a/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go b/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go index 17d5a36b..074c712e 100644 --- a/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go +++ b/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go @@ -26,7 +26,7 @@ func Test_Problem300(t *testing.T) { qs := []question300{ - question300{ + { para300{[]int{10, 9, 2, 5, 3, 7, 101, 18}}, ans300{4}, }, diff --git a/leetcode/0306.Additive-Number/306. Additive Number_test.go b/leetcode/0306.Additive-Number/306. Additive Number_test.go index 80e1478e..8191d720 100644 --- a/leetcode/0306.Additive-Number/306. Additive Number_test.go +++ b/leetcode/0306.Additive-Number/306. Additive Number_test.go @@ -26,12 +26,12 @@ func Test_Problem306(t *testing.T) { qs := []question306{ - question306{ + { para306{"112358"}, ans306{true}, }, - question306{ + { para306{"199100199"}, ans306{true}, }, diff --git a/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown_test.go b/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown_test.go index ed8a0418..1204bef6 100644 --- a/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown_test.go +++ b/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown_test.go @@ -26,32 +26,32 @@ func Test_Problem309(t *testing.T) { qs := []question309{ - question309{ + { para309{[]int{}}, ans309{0}, }, - question309{ + { para309{[]int{2, 1, 4, 5, 2, 9, 7}}, ans309{10}, }, - question309{ + { para309{[]int{6, 1, 3, 2, 4, 7}}, ans309{6}, }, - question309{ + { para309{[]int{1, 2, 3, 0, 2}}, ans309{3}, }, - question309{ + { para309{[]int{7, 1, 5, 3, 6, 4}}, ans309{5}, }, - question309{ + { para309{[]int{7, 6, 4, 3, 1}}, ans309{0}, }, diff --git a/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go b/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go index 82b31ad6..35579fcf 100644 --- a/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go +++ b/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go @@ -26,17 +26,17 @@ func Test_Problem315(t *testing.T) { qs := []question315{ - question315{ + { para315{[]int{5, 2, 6, 1}}, ans315{[]int{2, 1, 1, 0}}, }, - question315{ + { para315{[]int{-1, -1}}, ans315{[]int{0, 0}}, }, - question315{ + { para315{[]int{26, 78, 27, 100, 33, 67, 90, 23, 66, 5, 38, 7, 35, 23, 52, 22, 83, 51, 98, 69, 81, 32, 78, 28, 94, 13, 2, 97, 3, 76, 99, 51, 9, 21, 84, 66, 65, 36, 100, 41}}, ans315{[]int{10, 27, 10, 35, 12, 22, 28, 8, 19, 2, 12, 2, 9, 6, 12, 5, 17, 9, 19, 12, 14, 6, 12, 5, 12, 3, 0, 10, 0, 7, 8, 4, 0, 0, 4, 3, 2, 0, 1, 0}}, }, diff --git a/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go b/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go index 84078b20..3c7a10fd 100644 --- a/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go +++ b/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go @@ -26,17 +26,17 @@ func Test_Problem318(t *testing.T) { qs := []question318{ - question318{ + { para318{[]string{"abcw", "baz", "foo", "bar", "xtfn", "abcdef"}}, ans318{16}, }, - question318{ + { para318{[]string{"a", "ab", "abc", "d", "cd", "bcd", "abcd"}}, ans318{4}, }, - question318{ + { para318{[]string{"a", "aa", "aaa", "aaaa"}}, ans318{0}, }, diff --git a/leetcode/0322.Coin-Change/322. Coin Change_test.go b/leetcode/0322.Coin-Change/322. Coin Change_test.go index 90363403..8f7fe2f5 100644 --- a/leetcode/0322.Coin-Change/322. Coin Change_test.go +++ b/leetcode/0322.Coin-Change/322. Coin Change_test.go @@ -27,26 +27,26 @@ func Test_Problem322(t *testing.T) { qs := []question322{ - question322{ + { para322{[]int{186, 419, 83, 408}, 6249}, ans322{20}, }, - question322{ + { para322{[]int{1, 2147483647}, 2}, ans322{2}, }, - question322{ + { para322{[]int{1, 2, 5}, 11}, ans322{3}, }, - question322{ + { para322{[]int{2}, 3}, ans322{-1}, }, - question322{ + { para322{[]int{1}, 0}, ans322{0}, }, diff --git a/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go b/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go index a9c4cba5..9885673b 100644 --- a/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go +++ b/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go @@ -26,27 +26,27 @@ func Test_Problem324(t *testing.T) { qs := []question324{ - question324{ + { para324{[]int{}}, ans324{[]int{}}, }, - question324{ + { para324{[]int{1}}, ans324{[]int{1}}, }, - question324{ + { para324{[]int{1, 5, 1, 1, 6, 4}}, ans324{[]int{1, 4, 1, 5, 1, 6}}, }, - question324{ + { para324{[]int{1, 3, 2, 2, 3, 1}}, ans324{[]int{2, 3, 1, 3, 1, 2}}, }, - question324{ + { para324{[]int{1, 1, 2, 1, 2, 2, 1}}, ans324{[]int{1, 2, 1, 2, 1, 2, 1}}, }, diff --git a/leetcode/0326.Power-of-Three/326. Power of Three_test.go b/leetcode/0326.Power-of-Three/326. Power of Three_test.go index b338d872..48ba0a6f 100644 --- a/leetcode/0326.Power-of-Three/326. Power of Three_test.go +++ b/leetcode/0326.Power-of-Three/326. Power of Three_test.go @@ -26,22 +26,22 @@ func Test_Problem326(t *testing.T) { qs := []question326{ - question326{ + { para326{27}, ans326{true}, }, - question326{ + { para326{0}, ans326{false}, }, - question326{ + { para326{9}, ans326{true}, }, - question326{ + { para326{45}, ans326{false}, }, diff --git a/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go b/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go index e0512ed7..555a63e4 100644 --- a/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go +++ b/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go @@ -28,17 +28,17 @@ func Test_Problem327(t *testing.T) { qs := []question327{ - question327{ + { para327{[]int{-2, 5, -1}, -2, 2}, ans327{3}, }, - question327{ + { para327{[]int{0, -3, -3, 1, 1, 2}, 3, 5}, ans327{2}, }, - question327{ + { para327{[]int{-3, 1, 2, -2, 2, -1}, -3, -1}, ans327{7}, }, diff --git a/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List_test.go b/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List_test.go index 5e3547ac..6488dd54 100644 --- a/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List_test.go +++ b/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List_test.go @@ -28,37 +28,37 @@ func Test_Problem328(t *testing.T) { qs := []question328{ - question328{ + { para328{[]int{1, 4, 3, 2, 5, 2}}, ans328{[]int{1, 3, 5, 4, 2, 2}}, }, - question328{ + { para328{[]int{1, 1, 2, 2, 3, 3, 3}}, ans328{[]int{1, 2, 3, 3, 1, 2, 3}}, }, - question328{ + { para328{[]int{4, 3, 2, 5, 2}}, ans328{[]int{4, 2, 2, 3, 5}}, }, - question328{ + { para328{[]int{1, 1, 1, 1, 1, 1}}, ans328{[]int{1, 1, 1, 1, 1, 1}}, }, - question328{ + { para328{[]int{3, 1}}, ans328{[]int{3, 1}}, }, - question328{ + { para328{[]int{1, 2, 3, 4, 5}}, ans328{[]int{1, 3, 5, 2, 4}}, }, - question328{ + { para328{[]int{}}, ans328{[]int{}}, }, diff --git a/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix.go b/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix.go index 2e43102f..74287a05 100644 --- a/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix.go +++ b/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix.go @@ -5,10 +5,10 @@ import ( ) var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func longestIncreasingPath(matrix [][]int) int { diff --git a/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix_test.go b/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix_test.go index 4d8d754d..cda6bfe2 100644 --- a/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix_test.go +++ b/leetcode/0329.Longest-Increasing-Path-in-a-Matrix/329. Longest Increasing Path in a Matrix_test.go @@ -26,33 +26,33 @@ func Test_Problem329(t *testing.T) { qs := []question329{ - question329{ - para329{[][]int{[]int{1}}}, + { + para329{[][]int{{1}}}, ans329{1}, }, - question329{ - para329{[][]int{[]int{}}}, + { + para329{[][]int{{}}}, ans329{0}, }, - question329{ - para329{[][]int{[]int{9, 9, 4}, []int{6, 6, 8}, []int{2, 1, 1}}}, + { + para329{[][]int{{9, 9, 4}, {6, 6, 8}, {2, 1, 1}}}, ans329{4}, }, - question329{ - para329{[][]int{[]int{3, 4, 5}, []int{3, 2, 6}, []int{2, 2, 1}}}, + { + para329{[][]int{{3, 4, 5}, {3, 2, 6}, {2, 2, 1}}}, ans329{4}, }, - question329{ - para329{[][]int{[]int{1, 5, 9}, []int{10, 11, 13}, []int{12, 13, 15}}}, + { + para329{[][]int{{1, 5, 9}, {10, 11, 13}, {12, 13, 15}}}, ans329{5}, }, - question329{ - para329{[][]int{[]int{1, 5, 7}, []int{11, 12, 13}, []int{12, 13, 15}}}, + { + para329{[][]int{{1, 5, 7}, {11, 12, 13}, {12, 13, 15}}}, ans329{5}, }, } diff --git a/leetcode/0331.Verify-Preorder-Serialization-of-a-Binary-Tree/331. Verify Preorder Serialization of a Binary Tree_test.go b/leetcode/0331.Verify-Preorder-Serialization-of-a-Binary-Tree/331. Verify Preorder Serialization of a Binary Tree_test.go index 026f13d2..977626fc 100644 --- a/leetcode/0331.Verify-Preorder-Serialization-of-a-Binary-Tree/331. Verify Preorder Serialization of a Binary Tree_test.go +++ b/leetcode/0331.Verify-Preorder-Serialization-of-a-Binary-Tree/331. Verify Preorder Serialization of a Binary Tree_test.go @@ -26,17 +26,17 @@ func Test_Problem331(t *testing.T) { qs := []question331{ - question331{ + { para331{"9,3,4,#,#,1,#,#,2,#,6,#,#"}, ans331{true}, }, - question331{ + { para331{"1,#"}, ans331{false}, }, - question331{ + { para331{"9,#,#,1"}, ans331{false}, }, diff --git a/leetcode/0337.House-Robber-III/337. House Robber III_test.go b/leetcode/0337.House-Robber-III/337. House Robber III_test.go index f25f1d4c..a05c7edb 100644 --- a/leetcode/0337.House-Robber-III/337. House Robber III_test.go +++ b/leetcode/0337.House-Robber-III/337. House Robber III_test.go @@ -28,17 +28,17 @@ func Test_Problem337(t *testing.T) { qs := []question337{ - question337{ + { para337{[]int{3, 2, 3, structures.NULL, 3, structures.NULL, 1}}, ans337{7}, }, - question337{ + { para337{[]int{}}, ans337{0}, }, - question337{ + { para337{[]int{3, 4, 5, 1, 3, structures.NULL, 1}}, ans337{9}, }, diff --git a/leetcode/0338.Counting-Bits/338. Counting Bits_test.go b/leetcode/0338.Counting-Bits/338. Counting Bits_test.go index b69f10e1..2ae0f7b5 100644 --- a/leetcode/0338.Counting-Bits/338. Counting Bits_test.go +++ b/leetcode/0338.Counting-Bits/338. Counting Bits_test.go @@ -26,12 +26,12 @@ func Test_Problem338(t *testing.T) { qs := []question338{ - question338{ + { para338{2}, ans338{[]int{0, 1, 1}}, }, - question338{ + { para338{5}, ans338{[]int{0, 1, 1, 2, 1, 2}}, }, diff --git a/leetcode/0342.Power-of-Four/342. Power of Four_test.go b/leetcode/0342.Power-of-Four/342. Power of Four_test.go index 7c5c4cfc..637f3b98 100644 --- a/leetcode/0342.Power-of-Four/342. Power of Four_test.go +++ b/leetcode/0342.Power-of-Four/342. Power of Four_test.go @@ -26,12 +26,12 @@ func Test_Problem342(t *testing.T) { qs := []question342{ - question342{ + { para342{16}, ans342{true}, }, - question342{ + { para342{5}, ans342{false}, }, diff --git a/leetcode/0343.Integer-Break/343. Integer Break_test.go b/leetcode/0343.Integer-Break/343. Integer Break_test.go index e82a448a..b6228af4 100644 --- a/leetcode/0343.Integer-Break/343. Integer Break_test.go +++ b/leetcode/0343.Integer-Break/343. Integer Break_test.go @@ -26,12 +26,12 @@ func Test_Problem343(t *testing.T) { qs := []question343{ - question343{ + { para343{2}, ans343{1}, }, - question343{ + { para343{10}, ans343{36}, }, diff --git a/leetcode/0344.Reverse-String/344. Reverse String_test.go b/leetcode/0344.Reverse-String/344. Reverse String_test.go index 71f4f554..68aa77b9 100644 --- a/leetcode/0344.Reverse-String/344. Reverse String_test.go +++ b/leetcode/0344.Reverse-String/344. Reverse String_test.go @@ -26,12 +26,12 @@ func Test_Problem344(t *testing.T) { qs := []question344{ - question344{ + { para344{[]byte{'h', 'e', 'l', 'l', 'o'}}, ans344{[]byte{'o', 'l', 'l', 'e', 'h'}}, }, - question344{ + { para344{[]byte{'H', 'a', 'n', 'n', 'a', 'h'}}, ans344{[]byte{'h', 'a', 'n', 'n', 'a', 'H'}}, }, diff --git a/leetcode/0345.Reverse-Vowels-of-a-String/345. Reverse Vowels of a String_test.go b/leetcode/0345.Reverse-Vowels-of-a-String/345. Reverse Vowels of a String_test.go index c47420a1..74585a12 100644 --- a/leetcode/0345.Reverse-Vowels-of-a-String/345. Reverse Vowels of a String_test.go +++ b/leetcode/0345.Reverse-Vowels-of-a-String/345. Reverse Vowels of a String_test.go @@ -26,17 +26,17 @@ func Test_Problem345(t *testing.T) { qs := []question345{ - question345{ + { para345{"hello"}, ans345{"holle"}, }, - question345{ + { para345{"leetcode"}, ans345{"leotcede"}, }, - question345{ + { para345{"aA"}, ans345{"Aa"}, }, diff --git a/leetcode/0347.Top-K-Frequent-Elements/347. Top K Frequent Elements_test.go b/leetcode/0347.Top-K-Frequent-Elements/347. Top K Frequent Elements_test.go index 8d28f9ad..0e6f050f 100644 --- a/leetcode/0347.Top-K-Frequent-Elements/347. Top K Frequent Elements_test.go +++ b/leetcode/0347.Top-K-Frequent-Elements/347. Top K Frequent Elements_test.go @@ -27,12 +27,12 @@ func Test_Problem347(t *testing.T) { qs := []question347{ - question347{ + { para347{[]int{1, 1, 1, 2, 2, 3}, 2}, ans347{[]int{1, 2}}, }, - question347{ + { para347{[]int{1}, 1}, ans347{[]int{1}}, }, diff --git a/leetcode/0349.Intersection-of-Two-Arrays/349. Intersection of Two Arrays_test.go b/leetcode/0349.Intersection-of-Two-Arrays/349. Intersection of Two Arrays_test.go index b17d4b5b..f4cc3319 100644 --- a/leetcode/0349.Intersection-of-Two-Arrays/349. Intersection of Two Arrays_test.go +++ b/leetcode/0349.Intersection-of-Two-Arrays/349. Intersection of Two Arrays_test.go @@ -27,32 +27,32 @@ func Test_Problem349(t *testing.T) { qs := []question349{ - question349{ + { para349{[]int{}, []int{}}, ans349{[]int{}}, }, - question349{ + { para349{[]int{1}, []int{1}}, ans349{[]int{1}}, }, - question349{ + { para349{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans349{[]int{1, 2, 3, 4}}, }, - question349{ + { para349{[]int{1, 2, 2, 1}, []int{2, 2}}, ans349{[]int{2}}, }, - question349{ + { para349{[]int{1}, []int{9, 9, 9, 9, 9}}, ans349{[]int{}}, }, - question349{ + { para349{[]int{4, 9, 5}, []int{9, 4, 9, 8, 4}}, ans349{[]int{9, 4}}, }, diff --git a/leetcode/0350.Intersection-of-Two-Arrays-II/350. Intersection of Two Arrays II_test.go b/leetcode/0350.Intersection-of-Two-Arrays-II/350. Intersection of Two Arrays II_test.go index 5ab6f411..cdfd4f76 100644 --- a/leetcode/0350.Intersection-of-Two-Arrays-II/350. Intersection of Two Arrays II_test.go +++ b/leetcode/0350.Intersection-of-Two-Arrays-II/350. Intersection of Two Arrays II_test.go @@ -27,37 +27,37 @@ func Test_Problem350(t *testing.T) { qs := []question350{ - question350{ + { para350{[]int{}, []int{}}, ans350{[]int{}}, }, - question350{ + { para350{[]int{1}, []int{1}}, ans350{[]int{1}}, }, - question350{ + { para350{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans350{[]int{1, 2, 3, 4}}, }, - question350{ + { para350{[]int{1, 2, 2, 1}, []int{2, 2}}, ans350{[]int{2, 2}}, }, - question350{ + { para350{[]int{1}, []int{9, 9, 9, 9, 9}}, ans350{[]int{}}, }, - question350{ + { para350{[]int{4, 9, 5}, []int{9, 4, 9, 8, 4}}, ans350{[]int{9, 4}}, }, - question350{ + { para350{[]int{4, 9, 5, 9, 4}, []int{9, 4, 9, 8, 4, 7, 9, 4, 4, 9}}, ans350{[]int{9, 4, 9, 4}}, }, diff --git a/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes_test.go b/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes_test.go index fecd0cf9..a477e019 100644 --- a/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes_test.go +++ b/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes_test.go @@ -26,8 +26,8 @@ func Test_Problem354(t *testing.T) { qs := []question354{ - question354{ - para354{[][]int{[]int{5, 4}, []int{6, 4}, []int{6, 7}, []int{2, 3}}}, + { + para354{[][]int{{5, 4}, {6, 4}, {6, 7}, {2, 3}}}, ans354{3}, }, } diff --git a/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go b/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go index 60b252d9..a2ea8955 100644 --- a/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go +++ b/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go @@ -26,32 +26,32 @@ func Test_Problem357(t *testing.T) { qs := []question357{ - question357{ + { para357{1}, ans357{10}, }, - question357{ + { para357{2}, ans357{91}, }, - question357{ + { para357{3}, ans357{739}, }, - question357{ + { para357{4}, ans357{5275}, }, - question357{ + { para357{5}, ans357{32491}, }, - question357{ + { para357{6}, ans357{168571}, }, diff --git a/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square_test.go b/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square_test.go index 2877dc4c..e7a1e6eb 100644 --- a/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square_test.go +++ b/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square_test.go @@ -26,37 +26,37 @@ func Test_Problem367(t *testing.T) { qs := []question367{ - question367{ + { para367{1}, ans367{true}, }, - question367{ + { para367{2}, ans367{false}, }, - question367{ + { para367{3}, ans367{false}, }, - question367{ + { para367{4}, ans367{true}, }, - question367{ + { para367{5}, ans367{false}, }, - question367{ + { para367{6}, ans367{false}, }, - question367{ + { para367{104976}, ans367{true}, }, diff --git a/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go b/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go index fa065c93..8a76c8dc 100644 --- a/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go +++ b/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go @@ -27,12 +27,12 @@ func Test_Problem371(t *testing.T) { qs := []question371{ - question371{ + { para371{1, 2}, ans371{3}, }, - question371{ + { para371{-2, 3}, ans371{1}, }, diff --git a/leetcode/0372.Super-Pow/372. Super Pow_test.go b/leetcode/0372.Super-Pow/372. Super Pow_test.go index c862d96c..75347ad4 100644 --- a/leetcode/0372.Super-Pow/372. Super Pow_test.go +++ b/leetcode/0372.Super-Pow/372. Super Pow_test.go @@ -27,12 +27,12 @@ func Test_Problem372(t *testing.T) { qs := []question372{ - question372{ + { para372{2, []int{3}}, ans372{8}, }, - question372{ + { para372{2, []int{1, 0}}, ans372{1024}, }, diff --git a/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go b/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go index 461b9e9f..214ace27 100644 --- a/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go +++ b/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go @@ -28,39 +28,39 @@ func Test_Problem373(t *testing.T) { qs := []question373{ - question373{ + { para373{[]int{1, 7, 11}, []int{2, 4, 6}, 3}, - ans373{[][]int{[]int{1, 2}, []int{1, 4}, []int{1, 6}}}, + ans373{[][]int{{1, 2}, {1, 4}, {1, 6}}}, }, - question373{ + { para373{[]int{1, 1, 2}, []int{1, 2, 3}, 2}, - ans373{[][]int{[]int{1, 1}, []int{1, 1}}}, + ans373{[][]int{{1, 1}, {1, 1}}}, }, - question373{ + { para373{[]int{1, 2}, []int{3}, 3}, - ans373{[][]int{[]int{1, 3}, []int{2, 3}}}, + ans373{[][]int{{1, 3}, {2, 3}}}, }, - question373{ + { para373{[]int{1, 2, 4, 5, 6}, []int{3, 5, 7, 9}, 3}, - ans373{[][]int{[]int{1, 3}, []int{2, 3}, []int{1, 5}}}, + ans373{[][]int{{1, 3}, {2, 3}, {1, 5}}}, }, - question373{ + { para373{[]int{1, 1, 2}, []int{1, 2, 3}, 10}, - ans373{[][]int{[]int{1, 1}, []int{1, 1}, []int{2, 1}, []int{1, 2}, []int{1, 2}, []int{2, 2}, []int{1, 3}, []int{1, 3}, []int{2, 3}}}, + ans373{[][]int{{1, 1}, {1, 1}, {2, 1}, {1, 2}, {1, 2}, {2, 2}, {1, 3}, {1, 3}, {2, 3}}}, }, - question373{ + { para373{[]int{-10, -4, 0, 0, 6}, []int{3, 5, 6, 7, 8, 100}, 10}, - ans373{[][]int{[]int{-10, 3}, []int{-10, 5}, []int{-10, 6}, []int{-10, 7}, []int{-10, 8}, []int{-4, 3}, []int{-4, 5}, []int{-4, 6}, []int{0, 3}, []int{0, 3}}}, + ans373{[][]int{{-10, 3}, {-10, 5}, {-10, 6}, {-10, 7}, {-10, 8}, {-4, 3}, {-4, 5}, {-4, 6}, {0, 3}, {0, 3}}}, }, - question373{ + { para373{[]int{0, 0, 0, 0, 0}, []int{-3, 22, 35, 56, 76}, 22}, - ans373{[][]int{[]int{0, -3}, []int{0, -3}, []int{0, -3}, []int{0, -3}, []int{0, -3}, []int{0, 22}, []int{0, 22}, []int{0, 22}, []int{0, 22}, []int{0, 22}, []int{0, 35}, []int{0, 35}, []int{0, 35}, []int{0, 35}, []int{0, 35}, []int{0, 56}, []int{0, 56}, []int{0, 56}, []int{0, 56}, []int{0, 56}, []int{0, 76}, []int{0, 76}}}, + ans373{[][]int{{0, -3}, {0, -3}, {0, -3}, {0, -3}, {0, -3}, {0, 22}, {0, 22}, {0, 22}, {0, 22}, {0, 22}, {0, 35}, {0, 35}, {0, 35}, {0, 35}, {0, 35}, {0, 56}, {0, 56}, {0, 56}, {0, 56}, {0, 56}, {0, 76}, {0, 76}}}, }, } diff --git a/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go b/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go index 8019a021..021828aa 100644 --- a/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go +++ b/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go @@ -27,13 +27,13 @@ func Test_Problem378(t *testing.T) { qs := []question378{ - question378{ - para378{[][]int{[]int{1, 5, 9}, []int{10, 11, 13}, []int{12, 13, 15}}, 8}, + { + para378{[][]int{{1, 5, 9}, {10, 11, 13}, {12, 13, 15}}, 8}, ans378{13}, }, - question378{ - para378{[][]int{[]int{1, 5, 7}, []int{11, 12, 13}, []int{12, 13, 15}}, 3}, + { + para378{[][]int{{1, 5, 7}, {11, 12, 13}, {12, 13, 15}}, 3}, ans378{9}, }, } diff --git a/leetcode/0385.Mini-Parser/385. Mini Parser_test.go b/leetcode/0385.Mini-Parser/385. Mini Parser_test.go index 8ca47fb5..f3efe64d 100644 --- a/leetcode/0385.Mini-Parser/385. Mini Parser_test.go +++ b/leetcode/0385.Mini-Parser/385. Mini Parser_test.go @@ -26,27 +26,27 @@ func Test_Problem385(t *testing.T) { qs := []question385{ - question385{ + { para385{"[[]]"}, ans385{[]int{}}, }, - question385{ + { para385{"[]"}, ans385{[]int{}}, }, - question385{ + { para385{"[-1]"}, ans385{[]int{-1}}, }, - question385{ + { para385{"[123,[456,[789]]]"}, ans385{[]int{123, 456, 789}}, }, - question385{ + { para385{"324"}, ans385{[]int{324}}, }, diff --git a/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers_test.go b/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers_test.go index 4a72edef..eb0d60fb 100644 --- a/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers_test.go +++ b/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers_test.go @@ -26,7 +26,7 @@ func Test_Problem386(t *testing.T) { qs := []question386{ - question386{ + { para386{13}, ans386{[]int{1, 10, 11, 12, 13, 2, 3, 4, 5, 6, 7, 8, 9}}, }, diff --git a/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go b/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go index a400f081..fd0b6d1f 100644 --- a/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go +++ b/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go @@ -26,12 +26,12 @@ func Test_Problem387(t *testing.T) { qs := []question387{ - question387{ + { para387{"leetcode"}, ans387{0}, }, - question387{ + { para387{"loveleetcode"}, ans387{2}, }, diff --git a/leetcode/0389.Find-the-Difference/389. Find the Difference_test.go b/leetcode/0389.Find-the-Difference/389. Find the Difference_test.go index a42b722e..6f31d7ad 100644 --- a/leetcode/0389.Find-the-Difference/389. Find the Difference_test.go +++ b/leetcode/0389.Find-the-Difference/389. Find the Difference_test.go @@ -27,7 +27,7 @@ func Test_Problem389(t *testing.T) { qs := []question389{ - question389{ + { para389{"abcd", "abcde"}, ans389{'e'}, }, diff --git a/leetcode/0392.Is-Subsequence/392. Is Subsequence.go b/leetcode/0392.Is-Subsequence/392. Is Subsequence.go index 0c9027b9..2098cb93 100644 --- a/leetcode/0392.Is-Subsequence/392. Is Subsequence.go +++ b/leetcode/0392.Is-Subsequence/392. Is Subsequence.go @@ -2,9 +2,9 @@ package leetcode // 解法一 O(n^2) func isSubsequence(s string, t string) bool { - index, flag := 0, false + index := 0 for i := 0; i < len(s); i++ { - flag = false + flag := false for ; index < len(t); index++ { if s[i] == t[index] { flag = true diff --git a/leetcode/0392.Is-Subsequence/392. Is Subsequence_test.go b/leetcode/0392.Is-Subsequence/392. Is Subsequence_test.go index 8e2c023b..8c565e66 100644 --- a/leetcode/0392.Is-Subsequence/392. Is Subsequence_test.go +++ b/leetcode/0392.Is-Subsequence/392. Is Subsequence_test.go @@ -27,22 +27,22 @@ func Test_Problem392(t *testing.T) { qs := []question392{ - question392{ + { para392{"abc", "ahbgdc"}, ans392{true}, }, - question392{ + { para392{"axc", "ahbgdc"}, ans392{false}, }, - question392{ + { para392{"acb", "ahbgdc"}, ans392{false}, }, - question392{ + { para392{"leeeeetcode", "yyyyylyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyeyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyeyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyeyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyytyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyycyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyoyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyydyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyeyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy"}, ans392{false}, }, diff --git a/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go b/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go index 9700becc..25ba67e6 100644 --- a/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go +++ b/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go @@ -26,12 +26,12 @@ func Test_Problem393(t *testing.T) { qs := []question393{ - question393{ + { para393{[]int{197, 130, 1}}, ans393{true}, }, - question393{ + { para393{[]int{235, 140, 4}}, ans393{false}, }, diff --git a/leetcode/0394.Decode-String/394. Decode String_test.go b/leetcode/0394.Decode-String/394. Decode String_test.go index 50846ccc..b7434e46 100644 --- a/leetcode/0394.Decode-String/394. Decode String_test.go +++ b/leetcode/0394.Decode-String/394. Decode String_test.go @@ -26,22 +26,22 @@ func Test_Problem394(t *testing.T) { qs := []question394{ - question394{ + { para394{"10[a]"}, ans394{"aaaaaaaaaa"}, }, - question394{ + { para394{"3[a]2[bc]"}, ans394{"aaabcbc"}, }, - question394{ + { para394{"3[a2[c]]"}, ans394{"accaccacc"}, }, - question394{ + { para394{"2[abc]3[cd]ef"}, ans394{"abcabccdcdcdef"}, }, diff --git a/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go b/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go index ffdab849..dc9ab7d3 100644 --- a/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go +++ b/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go @@ -26,12 +26,12 @@ func Test_Problem397(t *testing.T) { qs := []question397{ - question397{ + { para397{8}, ans397{3}, }, - question397{ + { para397{7}, ans397{4}, }, diff --git a/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go b/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go index 3959ce14..abbcf0af 100644 --- a/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go +++ b/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go @@ -28,8 +28,8 @@ func Test_Problem399(t *testing.T) { qs := []question399{ - question399{ - para399{[][]string{[]string{"a", "b"}, []string{"b", "c"}}, []float64{2.0, 3.0}, [][]string{[]string{"a", "c"}, []string{"b", "a"}, []string{"a", "e"}, []string{"a", "a"}, []string{"x", "x"}}}, + { + para399{[][]string{{"a", "b"}, {"b", "c"}}, []float64{2.0, 3.0}, [][]string{{"a", "c"}, {"b", "a"}, {"a", "e"}, {"a", "a"}, {"x", "x"}}}, ans399{[]float64{6.0, 0.5, -1.0, 1.0, -1.0}}, }, } diff --git a/leetcode/0401.Binary-Watch/401. Binary Watch.go b/leetcode/0401.Binary-Watch/401. Binary Watch.go index cf8c8488..cd42713a 100644 --- a/leetcode/0401.Binary-Watch/401. Binary Watch.go +++ b/leetcode/0401.Binary-Watch/401. Binary Watch.go @@ -9,18 +9,18 @@ var ( hour = []string{"1", "2", "4", "8"} minute = []string{"01", "02", "04", "08", "16", "32"} hourMap = map[int][]string{ - 0: []string{"0"}, - 1: []string{"1", "2", "4", "8"}, - 2: []string{"3", "5", "9", "6", "10"}, - 3: []string{"7", "11"}, + 0: {"0"}, + 1: {"1", "2", "4", "8"}, + 2: {"3", "5", "9", "6", "10"}, + 3: {"7", "11"}, } minuteMap = map[int][]string{ - 0: []string{"00"}, - 1: []string{"01", "02", "04", "08", "16", "32"}, - 2: []string{"03", "05", "09", "17", "33", "06", "10", "18", "34", "12", "20", "36", "24", "40", "48"}, - 3: []string{"07", "11", "19", "35", "13", "21", "37", "25", "41", "49", "14", "22", "38", "26", "42", "50", "28", "44", "52", "56"}, - 4: []string{"15", "23", "39", "27", "43", "51", "29", "45", "53", "57", "30", "46", "54", "58"}, - 5: []string{"31", "47", "55", "59"}, + 0: {"00"}, + 1: {"01", "02", "04", "08", "16", "32"}, + 2: {"03", "05", "09", "17", "33", "06", "10", "18", "34", "12", "20", "36", "24", "40", "48"}, + 3: {"07", "11", "19", "35", "13", "21", "37", "25", "41", "49", "14", "22", "38", "26", "42", "50", "28", "44", "52", "56"}, + 4: {"15", "23", "39", "27", "43", "51", "29", "45", "53", "57", "30", "46", "54", "58"}, + 5: {"31", "47", "55", "59"}, } ) diff --git a/leetcode/0401.Binary-Watch/401. Binary Watch_test.go b/leetcode/0401.Binary-Watch/401. Binary Watch_test.go index 5eb18e8e..745cd4bb 100644 --- a/leetcode/0401.Binary-Watch/401. Binary Watch_test.go +++ b/leetcode/0401.Binary-Watch/401. Binary Watch_test.go @@ -26,7 +26,7 @@ func Test_Problem401(t *testing.T) { qs := []question401{ - question401{ + { para401{1}, ans401{[]string{"1:00", "2:00", "4:00", "8:00", "0:01", "0:02", "0:04", "0:08", "0:16", "0:32"}}, }, diff --git a/leetcode/0402.Remove-K-Digits/402. Remove K Digits_test.go b/leetcode/0402.Remove-K-Digits/402. Remove K Digits_test.go index 5b0b502d..f9b23418 100644 --- a/leetcode/0402.Remove-K-Digits/402. Remove K Digits_test.go +++ b/leetcode/0402.Remove-K-Digits/402. Remove K Digits_test.go @@ -26,42 +26,42 @@ type ans402 struct { func Test_Problem402(t *testing.T) { qs := []question402{ - question402{ + { para402{"10", 1}, ans402{"0"}, }, - question402{ + { para402{"1111111", 3}, ans402{"1111"}, }, - question402{ + { para402{"5337", 2}, ans402{"33"}, }, - question402{ + { para402{"112", 1}, ans402{"11"}, }, - question402{ + { para402{"1432219", 3}, ans402{"1219"}, }, - question402{ + { para402{"10200", 1}, ans402{"200"}, }, - question402{ + { para402{"10", 2}, ans402{"0"}, }, - question402{ + { para402{"19", 2}, ans402{"0"}, }, diff --git a/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves_test.go b/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves_test.go index bdfd80bc..09a66521 100644 --- a/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves_test.go +++ b/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves_test.go @@ -28,12 +28,12 @@ func Test_Problem404(t *testing.T) { qs := []question404{ - question404{ + { para404{[]int{}}, ans404{0}, }, - question404{ + { para404{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans404{24}, }, diff --git a/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go b/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go index ef7c7fa5..e4aafd85 100644 --- a/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go +++ b/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go @@ -26,12 +26,12 @@ func Test_Problem405(t *testing.T) { qs := []question405{ - question405{ + { para405{26}, ans405{"1a"}, }, - question405{ + { para405{-1}, ans405{"ffffffff"}, }, diff --git a/leetcode/0409.Longest-Palindrome/409. Longest Palindrome_test.go b/leetcode/0409.Longest-Palindrome/409. Longest Palindrome_test.go index c6f49e73..ee023dc8 100644 --- a/leetcode/0409.Longest-Palindrome/409. Longest Palindrome_test.go +++ b/leetcode/0409.Longest-Palindrome/409. Longest Palindrome_test.go @@ -26,7 +26,7 @@ func Test_Problem409(t *testing.T) { qs := []question409{ - question409{ + { para409{"abccccdd"}, ans409{7}, }, diff --git a/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go b/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go index 574ca124..31e5fd05 100644 --- a/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go +++ b/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go @@ -27,7 +27,7 @@ func Test_Problem410(t *testing.T) { qs := []question410{ - question410{ + { para410{[]int{7, 2, 5, 10, 8}, 2}, ans410{18}, }, diff --git a/leetcode/0414.Third-Maximum-Number/414. Third Maximum Number_test.go b/leetcode/0414.Third-Maximum-Number/414. Third Maximum Number_test.go index 062cc829..522784dd 100644 --- a/leetcode/0414.Third-Maximum-Number/414. Third Maximum Number_test.go +++ b/leetcode/0414.Third-Maximum-Number/414. Third Maximum Number_test.go @@ -26,22 +26,22 @@ func Test_Problem414(t *testing.T) { qs := []question414{ - question414{ + { para414{[]int{1, 1, 2}}, ans414{2}, }, - question414{ + { para414{[]int{3, 2, 1}}, ans414{1}, }, - question414{ + { para414{[]int{1, 2}}, ans414{2}, }, - question414{ + { para414{[]int{2, 2, 3, 1}}, ans414{1}, }, diff --git a/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum_test.go b/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum_test.go index 4e26f632..fdceb0b0 100644 --- a/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum_test.go +++ b/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum_test.go @@ -26,17 +26,17 @@ func Test_Problem416(t *testing.T) { qs := []question416{ - question416{ + { para416{[]int{1, 5, 11, 5}}, ans416{true}, }, - question416{ + { para416{[]int{1, 2, 3, 5}}, ans416{false}, }, - question416{ + { para416{[]int{1, 2, 5}}, ans416{false}, }, diff --git a/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go b/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go index c7225f6f..7369f845 100644 --- a/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go +++ b/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go @@ -26,7 +26,7 @@ func Test_Problem421(t *testing.T) { qs := []question421{ - question421{ + { para421{[]int{3, 10, 5, 25, 2, 8}}, ans421{28}, }, diff --git a/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go b/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go index 7c1a0b40..8ccd0c08 100644 --- a/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go +++ b/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go @@ -1,8 +1,8 @@ package leetcode func characterReplacement(s string, k int) int { - res, left, right, counter, freq := 0, 0, 1, 0, make([]int, 26) - for right = 0; right < len(s); right++ { + res, left, counter, freq := 0, 0, 0, make([]int, 26) + for right := 0; right < len(s); right++ { freq[s[right]-'A']++ counter = max(counter, freq[s[right]-'A']) for right-left+1-counter > k { diff --git a/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement_test.go b/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement_test.go index 2c3d5bd3..3ec26313 100644 --- a/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement_test.go +++ b/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement_test.go @@ -27,27 +27,27 @@ func Test_Problem424(t *testing.T) { qs := []question424{ - question424{ + { para424{"AABABBA", 1}, ans424{4}, }, - question424{ + { para424{"ABBB", 2}, ans424{4}, }, - question424{ + { para424{"BAAA", 0}, ans424{3}, }, - question424{ + { para424{"ABCDE", 1}, ans424{2}, }, - question424{ + { para424{"BAAAB", 2}, ans424{5}, }, diff --git a/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation_test.go b/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation_test.go index 0bec4713..57e7a2cb 100644 --- a/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation_test.go +++ b/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation_test.go @@ -27,22 +27,22 @@ type ans433 struct { func Test_Problem433(t *testing.T) { qs := []question433{ - question433{ + { para433{"AACCGGTT", "AACCGGTA", []string{"AACCGGTA"}}, ans433{1}, }, - question433{ + { para433{"AACCGGTT", "AAACGGTA", []string{"AACCGGTA", "AACCGCTA", "AAACGGTA"}}, ans433{2}, }, - question433{ + { para433{"AAAAACCC", "AACCCCCC", []string{"AAAACCCC", "AAACCCCC", "AACCCCCC"}}, ans433{3}, }, - question433{ + { para433{"AACCGGTT", "AACCGGTA", []string{}}, ans433{-1}, }, diff --git a/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go b/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go index 3050bc8a..059a118b 100644 --- a/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go +++ b/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go @@ -26,18 +26,18 @@ func Test_Problem435(t *testing.T) { qs := []question435{ - question435{ - para435{[][]int{[]int{1, 2}, []int{2, 3}, []int{3, 4}, []int{1, 3}}}, + { + para435{[][]int{{1, 2}, {2, 3}, {3, 4}, {1, 3}}}, ans435{1}, }, - question435{ - para435{[][]int{[]int{1, 2}, []int{1, 2}, []int{1, 2}}}, + { + para435{[][]int{{1, 2}, {1, 2}, {1, 2}}}, ans435{2}, }, - question435{ - para435{[][]int{[]int{1, 2}, []int{2, 3}}}, + { + para435{[][]int{{1, 2}, {2, 3}}}, ans435{0}, }, } diff --git a/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go b/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go index 6749c448..d3d209df 100644 --- a/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go +++ b/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go @@ -26,18 +26,18 @@ func Test_Problem436(t *testing.T) { qs := []question436{ - question436{ - para436{[][]int{[]int{3, 4}, []int{2, 3}, []int{1, 2}}}, + { + para436{[][]int{{3, 4}, {2, 3}, {1, 2}}}, ans436{[]int{-1, 0, 1}}, }, - question436{ - para436{[][]int{[]int{1, 4}, []int{2, 3}, []int{3, 4}}}, + { + para436{[][]int{{1, 4}, {2, 3}, {3, 4}}}, ans436{[]int{-1, 2, -1}}, }, - question436{ - para436{[][]int{[]int{1, 2}}}, + { + para436{[][]int{{1, 2}}}, ans436{[]int{-1}}, }, } diff --git a/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go b/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go index 4b19a671..4f122a2d 100644 --- a/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go +++ b/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go @@ -28,12 +28,12 @@ type ans437 struct { func Test_Problem437(t *testing.T) { qs := []question437{ - question437{ + { para437{[]int{}, 0}, ans437{0}, }, - question437{ + { para437{[]int{10, 5, -3, 3, 2, structures.NULL, 11, 3, -2, structures.NULL, 1}, 8}, ans437{3}, }, diff --git a/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String_test.go b/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String_test.go index 1fcd08cd..8d457e4e 100644 --- a/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String_test.go +++ b/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String_test.go @@ -27,22 +27,22 @@ func Test_Problem438(t *testing.T) { qs := []question438{ - question438{ + { para438{"abab", "ab"}, ans438{[]int{0, 1, 2}}, }, - question438{ + { para438{"cbaebabacd", "abc"}, ans438{[]int{0, 6}}, }, - question438{ + { para438{"", "abc"}, ans438{[]int{}}, }, - question438{ + { para438{"abacbabc", "abc"}, ans438{[]int{1, 2, 3, 5}}, }, diff --git a/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go b/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go index a5ac60cd..51f8403c 100644 --- a/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go +++ b/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go @@ -26,12 +26,12 @@ func Test_Problem441(t *testing.T) { qs := []question441{ - question441{ + { para441{5}, ans441{2}, }, - question441{ + { para441{8}, ans441{3}, }, diff --git a/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go b/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go index b2df6e74..fbdd48dd 100644 --- a/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go +++ b/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go @@ -29,42 +29,42 @@ func Test_Problem445(t *testing.T) { qs := []question445{ - question445{ + { para445{[]int{}, []int{}}, ans445{[]int{}}, }, - question445{ + { para445{[]int{1}, []int{1}}, ans445{[]int{2}}, }, - question445{ + { para445{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans445{[]int{2, 4, 6, 8}}, }, - question445{ + { para445{[]int{1, 2, 3, 4, 5}, []int{1, 2, 3, 4, 5}}, ans445{[]int{2, 4, 6, 9, 0}}, }, - question445{ + { para445{[]int{1}, []int{9, 9, 9, 9, 9}}, ans445{[]int{1, 0, 0, 0, 0, 0}}, }, - question445{ + { para445{[]int{9, 9, 9, 9, 9}, []int{1}}, ans445{[]int{1, 0, 0, 0, 0, 0}}, }, - question445{ + { para445{[]int{2, 4, 3}, []int{5, 6, 4}}, ans445{[]int{8, 0, 7}}, }, - question445{ + { para445{[]int{1, 8, 3}, []int{7, 1}}, ans445{[]int{2, 5, 4}}, }, diff --git a/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs_test.go b/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs_test.go index efa0c898..19e84708 100644 --- a/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs_test.go +++ b/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs_test.go @@ -26,8 +26,8 @@ func Test_Problem447(t *testing.T) { qs := []question447{ - question447{ - para447{[][]int{[]int{0, 0}, []int{1, 0}, []int{2, 0}}}, + { + para447{[][]int{{0, 0}, {1, 0}, {2, 0}}}, ans447{2}, }, diff --git a/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array_test.go b/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array_test.go index db946e23..232e56bf 100644 --- a/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array_test.go +++ b/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array_test.go @@ -26,12 +26,12 @@ func Test_Problem448(t *testing.T) { qs := []question448{ - question448{ + { para448{[]int{4, 3, 2, 7, 8, 2, 3, 1}}, ans448{[]int{5, 6}}, }, - question448{ + { para448{[]int{4, 3, 2, 10, 9, 2, 3, 1, 1, 1, 1}}, ans448{[]int{5, 6, 7, 8, 11}}, }, diff --git a/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go b/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go index e578af16..a46b9acd 100644 --- a/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go +++ b/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go @@ -25,17 +25,17 @@ type ans451 struct { func Test_Problem451(t *testing.T) { qs := []question451{ - question451{ + { para451{"tree"}, ans451{"eert"}, }, - question451{ + { para451{"cccaaa"}, ans451{"cccaaa"}, }, - question451{ + { para451{"Aabb"}, ans451{"bbAa"}, }, diff --git a/leetcode/0453.Minimum-Moves-to-Equal-Array-Elements/453. Minimum Moves to Equal Array Elements_test.go b/leetcode/0453.Minimum-Moves-to-Equal-Array-Elements/453. Minimum Moves to Equal Array Elements_test.go index 6a577b0f..93e37882 100644 --- a/leetcode/0453.Minimum-Moves-to-Equal-Array-Elements/453. Minimum Moves to Equal Array Elements_test.go +++ b/leetcode/0453.Minimum-Moves-to-Equal-Array-Elements/453. Minimum Moves to Equal Array Elements_test.go @@ -26,12 +26,12 @@ func Test_Problem453(t *testing.T) { qs := []question453{ - question453{ + { para453{[]int{4, 3, 2, 7, 8, 2, 3, 1}}, ans453{22}, }, - question453{ + { para453{[]int{1, 2, 3}}, ans453{3}, }, diff --git a/leetcode/0454.4Sum-II/454. 4Sum II_test.go b/leetcode/0454.4Sum-II/454. 4Sum II_test.go index 54fc5b42..dc567783 100644 --- a/leetcode/0454.4Sum-II/454. 4Sum II_test.go +++ b/leetcode/0454.4Sum-II/454. 4Sum II_test.go @@ -29,7 +29,7 @@ func Test_Problem454(t *testing.T) { qs := []question454{ - question454{ + { para454{[]int{1, 2}, []int{-2, -1}, []int{-1, 2}, []int{0, 2}}, ans454{2}, }, diff --git a/leetcode/0455.Assign-Cookies/455. Assign Cookies_test.go b/leetcode/0455.Assign-Cookies/455. Assign Cookies_test.go index e337930d..14fd09d3 100644 --- a/leetcode/0455.Assign-Cookies/455. Assign Cookies_test.go +++ b/leetcode/0455.Assign-Cookies/455. Assign Cookies_test.go @@ -27,12 +27,12 @@ func Test_Problem455(t *testing.T) { qs := []question455{ - question455{ + { para455{[]int{1, 2, 3}, []int{1, 1}}, ans455{1}, }, - question455{ + { para455{[]int{1, 2}, []int{1, 2, 3}}, ans455{2}, }, diff --git a/leetcode/0456.132-Pattern/456. 132 Pattern_test.go b/leetcode/0456.132-Pattern/456. 132 Pattern_test.go index 706bafb5..bcf7895e 100644 --- a/leetcode/0456.132-Pattern/456. 132 Pattern_test.go +++ b/leetcode/0456.132-Pattern/456. 132 Pattern_test.go @@ -26,27 +26,27 @@ func Test_Problem456(t *testing.T) { qs := []question456{ - question456{ + { para456{[]int{}}, ans456{false}, }, - question456{ + { para456{[]int{1, 2, 3, 4}}, ans456{false}, }, - question456{ + { para456{[]int{3, 1, 4, 2}}, ans456{true}, }, - question456{ + { para456{[]int{-1, 3, 2, 0}}, ans456{true}, }, - question456{ + { para456{[]int{3, 5, 0, 3, 4}}, ans456{true}, }, diff --git a/leetcode/0457.Circular-Array-Loop/457. Circular Array Loop_test.go b/leetcode/0457.Circular-Array-Loop/457. Circular Array Loop_test.go index 8d00c8c9..776e1f5a 100644 --- a/leetcode/0457.Circular-Array-Loop/457. Circular Array Loop_test.go +++ b/leetcode/0457.Circular-Array-Loop/457. Circular Array Loop_test.go @@ -26,41 +26,41 @@ func Test_Problem457(t *testing.T) { qs := []question457{ - question457{ + { para457{[]int{-1}}, ans457{false}, }, - question457{ + { para457{[]int{3, 1, 2}}, ans457{true}, }, - question457{ + { para457{[]int{-8, -1, 1, 7, 2}}, ans457{false}, }, - question457{ + { para457{[]int{-1, -2, -3, -4, -5}}, ans457{false}, }, - question457{ + { para457{[]int{}}, ans457{false}, }, - question457{ + { para457{[]int{2, -1, 1, 2, 2}}, ans457{true}, }, - question457{ + { para457{[]int{-1, 2}}, ans457{false}, }, - question457{ + { para457{[]int{-2, 1, -1, -2, -2}}, ans457{false}, }, diff --git a/leetcode/0461.Hamming-Distance/461. Hamming Distance_test.go b/leetcode/0461.Hamming-Distance/461. Hamming Distance_test.go index ba6a38ed..18f8395f 100644 --- a/leetcode/0461.Hamming-Distance/461. Hamming Distance_test.go +++ b/leetcode/0461.Hamming-Distance/461. Hamming Distance_test.go @@ -27,17 +27,17 @@ func Test_Problem461(t *testing.T) { qs := []question461{ - question461{ + { para461{1, 4}, ans461{2}, }, - question461{ + { para461{1, 1}, ans461{0}, }, - question461{ + { para461{1, 3}, ans461{1}, }, diff --git a/leetcode/0463.Island-Perimeter/463. Island Perimeter_test.go b/leetcode/0463.Island-Perimeter/463. Island Perimeter_test.go index 35dfa016..869cde43 100644 --- a/leetcode/0463.Island-Perimeter/463. Island Perimeter_test.go +++ b/leetcode/0463.Island-Perimeter/463. Island Perimeter_test.go @@ -26,8 +26,8 @@ func Test_Problem463(t *testing.T) { qs := []question463{ - question463{ - para463{[][]int{[]int{0, 1, 0, 0}, []int{1, 1, 1, 0}, []int{0, 1, 0, 0}, []int{1, 1, 0, 0}}}, + { + para463{[][]int{{0, 1, 0, 0}, {1, 1, 1, 0}, {0, 1, 0, 0}, {1, 1, 0, 0}}}, ans463{16}, }, } diff --git a/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7()_test.go b/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7()_test.go index 9cc1cc18..f53a88f8 100644 --- a/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7()_test.go +++ b/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7()_test.go @@ -25,17 +25,17 @@ func Test_Problem470(t *testing.T) { qs := []question470{ - question470{ + { para470{}, ans470{2}, }, - question470{ + { para470{}, ans470{0}, }, - question470{ + { para470{}, ans470{1}, }, diff --git a/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go b/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go index 8cfdbf72..286376ed 100644 --- a/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go +++ b/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go @@ -28,17 +28,17 @@ func Test_Problem474(t *testing.T) { qs := []question474{ - question474{ + { para474{[]string{"10", "0001", "111001", "1", "0"}, 5, 3}, ans474{4}, }, - question474{ + { para474{[]string{"10", "0", "1"}, 1, 1}, ans474{2}, }, - question474{ + { para474{[]string{}, 0, 0}, ans474{0}, }, diff --git a/leetcode/0475.Heaters/475. Heaters_test.go b/leetcode/0475.Heaters/475. Heaters_test.go index f39489ee..fffa88df 100644 --- a/leetcode/0475.Heaters/475. Heaters_test.go +++ b/leetcode/0475.Heaters/475. Heaters_test.go @@ -27,12 +27,12 @@ func Test_Problem475(t *testing.T) { qs := []question475{ - question475{ + { para475{[]int{1, 2, 3}, []int{2}}, ans475{1}, }, - question475{ + { para475{[]int{1, 2, 3, 4}, []int{1, 4}}, ans475{1}, }, diff --git a/leetcode/0476.Number-Complement/476. Number Complement_test.go b/leetcode/0476.Number-Complement/476. Number Complement_test.go index 64c33802..91c7288f 100644 --- a/leetcode/0476.Number-Complement/476. Number Complement_test.go +++ b/leetcode/0476.Number-Complement/476. Number Complement_test.go @@ -26,12 +26,12 @@ func Test_Problem476(t *testing.T) { qs := []question476{ - question476{ + { para476{5}, ans476{2}, }, - question476{ + { para476{1}, ans476{0}, }, diff --git a/leetcode/0477.Total-Hamming-Distance/477. Total Hamming Distance_test.go b/leetcode/0477.Total-Hamming-Distance/477. Total Hamming Distance_test.go index 5e69bae7..d612046a 100644 --- a/leetcode/0477.Total-Hamming-Distance/477. Total Hamming Distance_test.go +++ b/leetcode/0477.Total-Hamming-Distance/477. Total Hamming Distance_test.go @@ -26,7 +26,7 @@ func Test_Problem477(t *testing.T) { qs := []question477{ - question477{ + { para477{[]int{4, 14, 2}}, ans477{6}, }, diff --git a/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go b/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go index d5f3cfd6..fda29cce 100644 --- a/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go +++ b/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go @@ -27,7 +27,7 @@ func Test_Problem480(t *testing.T) { qs := []question480{ - question480{ + { para480{[]int{1, 3, -1, -3, 5, 3, 6, 7}, 3}, ans480{[]int{1, -1, -1, 3, 5, 6}}, }, diff --git a/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base_test.go b/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base_test.go index b85f1798..710548e1 100644 --- a/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base_test.go +++ b/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base_test.go @@ -26,22 +26,22 @@ func Test_Problem483(t *testing.T) { qs := []question483{ - question483{ + { para483{"13"}, ans483{"3"}, }, - question483{ + { para483{"4681"}, ans483{"8"}, }, - question483{ + { para483{"1000000000000000000"}, ans483{"999999999999999999"}, }, - question483{ + { para483{"727004545306745403"}, ans483{"727004545306745402"}, }, diff --git a/leetcode/0485.Max-Consecutive-Ones/485. Max Consecutive Ones_test.go b/leetcode/0485.Max-Consecutive-Ones/485. Max Consecutive Ones_test.go index 7f473b2b..6a2a69e1 100644 --- a/leetcode/0485.Max-Consecutive-Ones/485. Max Consecutive Ones_test.go +++ b/leetcode/0485.Max-Consecutive-Ones/485. Max Consecutive Ones_test.go @@ -26,12 +26,12 @@ func Test_Problem485(t *testing.T) { qs := []question485{ - question485{ + { para485{[]int{1, 1, 0, 1, 1, 1}}, ans485{3}, }, - question485{ + { para485{[]int{1, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 1, 1}}, ans485{4}, }, diff --git a/leetcode/0491.Increasing-Subsequences/491. Increasing Subsequences_test.go b/leetcode/0491.Increasing-Subsequences/491. Increasing Subsequences_test.go index 18f6e742..61602a2d 100644 --- a/leetcode/0491.Increasing-Subsequences/491. Increasing Subsequences_test.go +++ b/leetcode/0491.Increasing-Subsequences/491. Increasing Subsequences_test.go @@ -26,14 +26,14 @@ func Test_Problem491(t *testing.T) { qs := []question491{ - question491{ + { para491{[]int{4, 3, 2, 1}}, ans491{[][]int{}}, }, - question491{ + { para491{[]int{4, 6, 7, 7}}, - ans491{[][]int{[]int{4, 6}, []int{4, 7}, []int{4, 6, 7}, []int{4, 6, 7, 7}, []int{6, 7}, []int{6, 7, 7}, []int{7, 7}, []int{4, 7, 7}}}, + ans491{[][]int{{4, 6}, {4, 7}, {4, 6, 7}, {4, 6, 7, 7}, {6, 7}, {6, 7, 7}, {7, 7}, {4, 7, 7}}}, }, } diff --git a/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go b/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go index 12866f12..49ff2de2 100644 --- a/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go +++ b/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go @@ -26,22 +26,22 @@ func Test_Problem493(t *testing.T) { qs := []question493{ - question493{ + { para493{[]int{1, 3, 2, 3, 1}}, ans493{2}, }, - question493{ + { para493{[]int{2, 4, 3, 5, 1}}, ans493{3}, }, - question493{ + { para493{[]int{-5, -5}}, ans493{1}, }, - question493{ + { para493{[]int{2147483647, 2147483647, -2147483647, -2147483647, -2147483647, 2147483647}}, ans493{9}, }, diff --git a/leetcode/0494.Target-Sum/494. Target Sum_test.go b/leetcode/0494.Target-Sum/494. Target Sum_test.go index 2fc82c9a..76700ec0 100644 --- a/leetcode/0494.Target-Sum/494. Target Sum_test.go +++ b/leetcode/0494.Target-Sum/494. Target Sum_test.go @@ -27,7 +27,7 @@ func Test_Problem494(t *testing.T) { qs := []question494{ - question494{ + { para494{[]int{1, 1, 1, 1, 1}, 3}, ans494{5}, }, diff --git a/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go b/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go index b1b9125b..b70becf0 100644 --- a/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go +++ b/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go @@ -4,12 +4,12 @@ func nextGreaterElement(nums1 []int, nums2 []int) []int { if len(nums1) == 0 || len(nums2) == 0 { return []int{} } - res, reocrd, flag := []int{}, map[int]int{}, false + res, reocrd := []int{}, map[int]int{} for i, v := range nums2 { reocrd[v] = i } for i := 0; i < len(nums1); i++ { - flag = false + flag := false for j := reocrd[nums1[i]]; j < len(nums2); j++ { if nums2[j] > nums1[i] { res = append(res, nums2[j]) diff --git a/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go b/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go index f030ecd3..52b8bb75 100644 --- a/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go +++ b/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go @@ -27,12 +27,12 @@ func Test_Problem496(t *testing.T) { qs := []question496{ - question496{ + { para496{[]int{4, 1, 2}, []int{1, 3, 4, 2}}, ans496{[]int{-1, 3, -1}}, }, - question496{ + { para496{[]int{2, 4}, []int{1, 2, 3, 4}}, ans496{[]int{3, -1}}, }, diff --git a/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go b/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go index f0d4c4c9..766d13d0 100644 --- a/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go +++ b/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go @@ -6,7 +6,7 @@ import ( ) func Test_Problem497(t *testing.T) { - w := [][]int{[]int{1, 1, 5, 5}} + w := [][]int{{1, 1, 5, 5}} sol := Constructor497(w) fmt.Printf("1.Pick = %v\n", sol.Pick()) fmt.Printf("2.Pick = %v\n", sol.Pick()) diff --git a/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go b/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go index b78ae3ff..a0f7458e 100644 --- a/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go +++ b/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go @@ -26,33 +26,33 @@ func Test_Problem498(t *testing.T) { qs := []question498{ - question498{ - para498{[][]int{[]int{3}, []int{2}, []int{9}}}, + { + para498{[][]int{{3}, {2}, {9}}}, ans498{[]int{3, 2, 9}}, }, - question498{ - para498{[][]int{[]int{6, 9, 7}}}, + { + para498{[][]int{{6, 9, 7}}}, ans498{[]int{6, 9, 7}}, }, - question498{ - para498{[][]int{[]int{3}, []int{2}}}, + { + para498{[][]int{{3}, {2}}}, ans498{[]int{3, 2}}, }, - question498{ - para498{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}, []int{7, 8, 9}}}, + { + para498{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}}, ans498{[]int{1, 2, 4, 7, 5, 3, 6, 8, 9}}, }, - question498{ - para498{[][]int{[]int{0}}}, + { + para498{[][]int{{0}}}, ans498{[]int{0}}, }, - question498{ - para498{[][]int{[]int{}}}, + { + para498{[][]int{{}}}, ans498{[]int{}}, }, } diff --git a/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go b/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go index 886fa47c..d05dfefa 100644 --- a/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go +++ b/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go @@ -26,7 +26,7 @@ func Test_Problem500(t *testing.T) { qs := []question500{ - question500{ + { para500{[]string{"Hello", "Alaska", "Dad", "Peace"}}, ans500{[]string{"Alaska", "Dad"}}, }, diff --git a/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II_test.go b/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II_test.go index 00844b11..f4cc3cfc 100644 --- a/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II_test.go +++ b/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II_test.go @@ -26,17 +26,17 @@ func Test_Problem503(t *testing.T) { qs := []question503{ - question503{ + { para503{[]int{}}, ans503{[]int{}}, }, - question503{ + { para503{[]int{1}}, ans503{[]int{-1}}, }, - question503{ + { para503{[]int{1, 2, 1}}, ans503{[]int{2, -1, 2}}, }, diff --git a/leetcode/0507.Perfect-Number/507. Perfect Number_test.go b/leetcode/0507.Perfect-Number/507. Perfect Number_test.go index 20aebcbd..eb9e1306 100644 --- a/leetcode/0507.Perfect-Number/507. Perfect Number_test.go +++ b/leetcode/0507.Perfect-Number/507. Perfect Number_test.go @@ -26,17 +26,17 @@ func Test_Problem507(t *testing.T) { qs := []question507{ - question507{ + { para507{28}, ans507{true}, }, - question507{ + { para507{496}, ans507{true}, }, - question507{ + { para507{500}, ans507{false}, }, diff --git a/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum_test.go b/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum_test.go index abb63667..fd58a61e 100644 --- a/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum_test.go +++ b/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum_test.go @@ -28,27 +28,27 @@ func Test_Problem508(t *testing.T) { qs := []question508{ - question508{ + { para508{[]int{}}, ans508{[]int{}}, }, - question508{ + { para508{[]int{1, 1}}, ans508{[]int{1, 2}}, }, - question508{ + { para508{[]int{1}}, ans508{[]int{1}}, }, - question508{ + { para508{[]int{5, 2, -3}}, ans508{[]int{2, -3, 4}}, }, - question508{ + { para508{[]int{5, 2, -5}}, ans508{[]int{2}}, }, diff --git a/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go b/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go index cc7bf04c..fbbc820c 100644 --- a/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go +++ b/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go @@ -26,17 +26,17 @@ func Test_Problem509(t *testing.T) { qs := []question509{ - question509{ + { para509{1}, ans509{1}, }, - question509{ + { para509{2}, ans509{1}, }, - question509{ + { para509{3}, ans509{2}, }, diff --git a/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value_test.go b/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value_test.go index 815a42ff..73f66fe3 100644 --- a/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value_test.go +++ b/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value_test.go @@ -28,22 +28,22 @@ func Test_Problem513(t *testing.T) { qs := []question513{ - question513{ + { para513{[]int{}}, ans513{0}, }, - question513{ + { para513{[]int{1}}, ans513{1}, }, - question513{ + { para513{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans513{15}, }, - question513{ + { para513{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, 5}}, ans513{4}, }, diff --git a/leetcode/0515.Find-Largest-Value-in-Each-Tree-Row/515. Find Largest Value in Each Tree Row_test.go b/leetcode/0515.Find-Largest-Value-in-Each-Tree-Row/515. Find Largest Value in Each Tree Row_test.go index 2c5a9c1c..d2847d35 100644 --- a/leetcode/0515.Find-Largest-Value-in-Each-Tree-Row/515. Find Largest Value in Each Tree Row_test.go +++ b/leetcode/0515.Find-Largest-Value-in-Each-Tree-Row/515. Find Largest Value in Each Tree Row_test.go @@ -28,22 +28,22 @@ func Test_Problem515(t *testing.T) { qs := []question515{ - question515{ + { para515{[]int{}}, ans515{[]int{}}, }, - question515{ + { para515{[]int{1}}, ans515{[]int{1}}, }, - question515{ + { para515{[]int{1, 3, 2, 5, 3, structures.NULL, 9}}, ans515{[]int{1, 3, 9}}, }, - question515{ + { para515{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans515{[]int{3, 20, 15}}, }, diff --git a/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting_test.go b/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting_test.go index b67f8073..be014285 100644 --- a/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting_test.go +++ b/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting_test.go @@ -27,27 +27,27 @@ func Test_Problem524(t *testing.T) { qs := []question524{ - question524{ + { para524{"abpcplea", []string{"ale", "apple", "monkey", "plea"}}, ans524{"apple"}, }, - question524{ + { para524{"abpcplea", []string{"a", "b", "c"}}, ans524{"a"}, }, - question524{ + { para524{"abpcplea", []string{"aaaaa", "b", "c"}}, ans524{"b"}, }, - question524{ + { para524{"bab", []string{"ba", "ab", "a", "b"}}, ans524{"ab"}, }, - question524{ + { para524{"aewfafwafjlwajflwajflwafj", []string{"apple", "ewaf", "awefawfwaf", "awef", "awefe", "ewafeffewafewf"}}, ans524{"ewaf"}, }, diff --git a/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go b/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go index 2ed14c1e..b592c076 100644 --- a/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go +++ b/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go @@ -26,92 +26,92 @@ func Test_Problem526(t *testing.T) { qs := []question526{ - question526{ + { para526{1}, ans526{1}, }, - question526{ + { para526{2}, ans526{2}, }, - question526{ + { para526{3}, ans526{3}, }, - question526{ + { para526{4}, ans526{8}, }, - question526{ + { para526{5}, ans526{10}, }, - question526{ + { para526{6}, ans526{36}, }, - question526{ + { para526{7}, ans526{41}, }, - question526{ + { para526{8}, ans526{132}, }, - question526{ + { para526{9}, ans526{250}, }, - question526{ + { para526{10}, ans526{700}, }, - question526{ + { para526{11}, ans526{750}, }, - question526{ + { para526{12}, ans526{4010}, }, - question526{ + { para526{13}, ans526{4237}, }, - question526{ + { para526{14}, ans526{10680}, }, - question526{ + { para526{15}, ans526{24679}, }, - question526{ + { para526{16}, ans526{87328}, }, - question526{ + { para526{17}, ans526{90478}, }, - question526{ + { para526{18}, ans526{435812}, }, diff --git a/leetcode/0529.Minesweeper/529. Minesweeper.go b/leetcode/0529.Minesweeper/529. Minesweeper.go index f279009e..aef5d2b8 100644 --- a/leetcode/0529.Minesweeper/529. Minesweeper.go +++ b/leetcode/0529.Minesweeper/529. Minesweeper.go @@ -1,14 +1,14 @@ package leetcode var dir8 = [][]int{ - []int{-1, -1}, - []int{-1, 0}, - []int{-1, 1}, - []int{0, 1}, - []int{1, 1}, - []int{1, 0}, - []int{1, -1}, - []int{0, -1}, + {-1, -1}, + {-1, 0}, + {-1, 1}, + {0, 1}, + {1, 1}, + {1, 0}, + {1, -1}, + {0, -1}, } func updateBoard(board [][]byte, click []int) [][]byte { diff --git a/leetcode/0529.Minesweeper/529. Minesweeper_test.go b/leetcode/0529.Minesweeper/529. Minesweeper_test.go index 97e8fe98..7a1b538a 100644 --- a/leetcode/0529.Minesweeper/529. Minesweeper_test.go +++ b/leetcode/0529.Minesweeper/529. Minesweeper_test.go @@ -27,33 +27,33 @@ func Test_Problem529(t *testing.T) { qs := []question529{ - question529{ + { para529{[][]byte{ - []byte{'E', 'E', 'E', 'E', 'E'}, - []byte{'E', 'E', 'M', 'E', 'E'}, - []byte{'E', 'E', 'E', 'E', 'E'}, - []byte{'E', 'E', 'E', 'E', 'E'}, + {'E', 'E', 'E', 'E', 'E'}, + {'E', 'E', 'M', 'E', 'E'}, + {'E', 'E', 'E', 'E', 'E'}, + {'E', 'E', 'E', 'E', 'E'}, }, []int{3, 0}}, ans529{[][]byte{ - []byte{'B', '1', 'E', '1', 'B'}, - []byte{'B', '1', 'M', '1', 'B'}, - []byte{'B', '1', '1', '1', 'B'}, - []byte{'B', 'B', 'B', 'B', 'B'}, + {'B', '1', 'E', '1', 'B'}, + {'B', '1', 'M', '1', 'B'}, + {'B', '1', '1', '1', 'B'}, + {'B', 'B', 'B', 'B', 'B'}, }}, }, - question529{ + { para529{[][]byte{ - []byte{'B', '1', 'E', '1', 'B'}, - []byte{'B', '1', 'M', '1', 'B'}, - []byte{'B', '1', '1', '1', 'B'}, - []byte{'B', 'B', 'B', 'B', 'B'}, + {'B', '1', 'E', '1', 'B'}, + {'B', '1', 'M', '1', 'B'}, + {'B', '1', '1', '1', 'B'}, + {'B', 'B', 'B', 'B', 'B'}, }, []int{1, 2}}, ans529{[][]byte{ - []byte{'B', '1', 'E', '1', 'B'}, - []byte{'B', '1', 'X', '1', 'B'}, - []byte{'B', '1', '1', '1', 'B'}, - []byte{'B', 'B', 'B', 'B', 'B'}, + {'B', '1', 'E', '1', 'B'}, + {'B', '1', 'X', '1', 'B'}, + {'B', '1', '1', '1', 'B'}, + {'B', 'B', 'B', 'B', 'B'}, }}, }, } diff --git a/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array_test.go b/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array_test.go index 2434bb68..dd895734 100644 --- a/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array_test.go +++ b/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array_test.go @@ -27,22 +27,22 @@ func Test_Problem532(t *testing.T) { qs := []question532{ - question532{ + { para532{[]int{3, 1, 4, 1, 5}, 2}, ans532{2}, }, - question532{ + { para532{[]int{1, 2, 3, 4, 5}, 1}, ans532{4}, }, - question532{ + { para532{[]int{1, 3, 1, 5, 4}, 0}, ans532{1}, }, - question532{ + { para532{[]int{}, 3}, ans532{0}, }, diff --git a/leetcode/0537.Complex-Number-Multiplication/537. Complex Number Multiplication_test.go b/leetcode/0537.Complex-Number-Multiplication/537. Complex Number Multiplication_test.go index 35ee1d1f..00d53dfd 100644 --- a/leetcode/0537.Complex-Number-Multiplication/537. Complex Number Multiplication_test.go +++ b/leetcode/0537.Complex-Number-Multiplication/537. Complex Number Multiplication_test.go @@ -27,12 +27,12 @@ func Test_Problem537(t *testing.T) { qs := []question537{ - question537{ + { para537{"1+1i", "1+1i"}, ans537{"0+2i"}, }, - question537{ + { para537{"1+-1i", "1+-1i"}, ans537{"0+-2i"}, }, diff --git a/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go b/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go index 358f0aa1..9c6d3ba5 100644 --- a/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go +++ b/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go @@ -27,22 +27,22 @@ func Test_Problem541(t *testing.T) { qs := []question541{ - question541{ + { para541{"abcdefg", 2}, ans541{"bacdfeg"}, }, - question541{ + { para541{"abcdefg", 5}, ans541{"edcbafg"}, }, - question541{ + { para541{"abcd", 4}, ans541{"dcba"}, }, - question541{ + { para541{"", 100}, ans541{""}, }, diff --git a/leetcode/0542.01-Matrix/542. 01 Matrix_test.go b/leetcode/0542.01-Matrix/542. 01 Matrix_test.go index efebe43b..643f4a93 100644 --- a/leetcode/0542.01-Matrix/542. 01 Matrix_test.go +++ b/leetcode/0542.01-Matrix/542. 01 Matrix_test.go @@ -26,19 +26,19 @@ func Test_Problem542(t *testing.T) { qs := []question542{ - question542{ - para542{[][]int{[]int{0, 0, 0}, []int{0, 1, 0}, []int{0, 0, 0}}}, - ans542{[][]int{[]int{0, 0, 0}, []int{0, 1, 0}, []int{0, 0, 0}}}, + { + para542{[][]int{{0, 0, 0}, {0, 1, 0}, {0, 0, 0}}}, + ans542{[][]int{{0, 0, 0}, {0, 1, 0}, {0, 0, 0}}}, }, - question542{ - para542{[][]int{[]int{0, 0, 0}, []int{0, 1, 0}, []int{1, 1, 1}}}, - ans542{[][]int{[]int{0, 0, 0}, []int{0, 1, 0}, []int{1, 2, 1}}}, + { + para542{[][]int{{0, 0, 0}, {0, 1, 0}, {1, 1, 1}}}, + ans542{[][]int{{0, 0, 0}, {0, 1, 0}, {1, 2, 1}}}, }, - question542{ - para542{[][]int{[]int{1, 1, 1, 1, 1, 1}, []int{1, 1, 1, 1, 1, 1}, []int{1, 1, 0, 0, 1, 1}, []int{1, 1, 0, 0, 1, 1}, []int{1, 1, 1, 1, 1, 1}, []int{1, 1, 1, 1, 1, 1}}}, - ans542{[][]int{[]int{4, 3, 2, 2, 3, 4}, []int{3, 2, 1, 1, 2, 3}, []int{2, 1, 0, 0, 1, 2}, []int{2, 1, 0, 0, 1, 2}, []int{3, 2, 1, 1, 2, 3}, []int{4, 3, 2, 2, 3, 4}}}, + { + para542{[][]int{{1, 1, 1, 1, 1, 1}, {1, 1, 1, 1, 1, 1}, {1, 1, 0, 0, 1, 1}, {1, 1, 0, 0, 1, 1}, {1, 1, 1, 1, 1, 1}, {1, 1, 1, 1, 1, 1}}}, + ans542{[][]int{{4, 3, 2, 2, 3, 4}, {3, 2, 1, 1, 2, 3}, {2, 1, 0, 0, 1, 2}, {2, 1, 0, 0, 1, 2}, {3, 2, 1, 1, 2, 3}, {4, 3, 2, 2, 3, 4}}}, }, } diff --git a/leetcode/0547.Friend-Circles/547. Friend Circles_test.go b/leetcode/0547.Friend-Circles/547. Friend Circles_test.go index d481f1a0..79c4bda8 100644 --- a/leetcode/0547.Friend-Circles/547. Friend Circles_test.go +++ b/leetcode/0547.Friend-Circles/547. Friend Circles_test.go @@ -26,18 +26,18 @@ func Test_Problem547(t *testing.T) { qs := []question547{ - question547{ - para547{[][]int{[]int{0, 0, 0}, []int{0, 1, 0}, []int{0, 0, 0}}}, + { + para547{[][]int{{0, 0, 0}, {0, 1, 0}, {0, 0, 0}}}, ans547{3}, }, - question547{ - para547{[][]int{[]int{1, 1, 0}, []int{1, 1, 0}, []int{0, 0, 1}}}, + { + para547{[][]int{{1, 1, 0}, {1, 1, 0}, {0, 0, 1}}}, ans547{2}, }, - question547{ - para547{[][]int{[]int{1, 1, 0}, []int{1, 1, 1}, []int{0, 1, 1}}}, + { + para547{[][]int{{1, 1, 0}, {1, 1, 1}, {0, 1, 1}}}, ans547{1}, }, } diff --git a/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III_test.go b/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III_test.go index 94b9e49d..812e5e78 100644 --- a/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III_test.go +++ b/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III_test.go @@ -26,12 +26,12 @@ func Test_Problem557(t *testing.T) { qs := []question557{ - question557{ + { para557{"Let's take LeetCode contest"}, ans557{"s'teL ekat edoCteeL tsetnoc"}, }, - question557{ + { para557{""}, ans557{""}, }, diff --git a/leetcode/0561.Array-Partition-I/561. Array Partition I_test.go b/leetcode/0561.Array-Partition-I/561. Array Partition I_test.go index ca062266..967365d5 100644 --- a/leetcode/0561.Array-Partition-I/561. Array Partition I_test.go +++ b/leetcode/0561.Array-Partition-I/561. Array Partition I_test.go @@ -26,12 +26,12 @@ func Test_Problem561(t *testing.T) { qs := []question561{ - question561{ + { para561{[]int{}}, ans561{0}, }, - question561{ + { para561{[]int{1, 4, 3, 2}}, ans561{4}, }, diff --git a/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt_test.go b/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt_test.go index 38083886..dcf6a3bf 100644 --- a/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt_test.go +++ b/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt_test.go @@ -28,27 +28,27 @@ func Test_Problem563(t *testing.T) { qs := []question563{ - question563{ + { para563{[]int{}}, ans563{0}, }, - question563{ + { para563{[]int{1}}, ans563{0}, }, - question563{ + { para563{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans563{41}, }, - question563{ + { para563{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, 5}}, ans563{11}, }, - question563{ + { para563{[]int{1, 2, 3, 4, structures.NULL, 5}}, ans563{11}, }, diff --git a/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go b/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go index 918ba9ec..4e33225b 100644 --- a/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go +++ b/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go @@ -28,14 +28,14 @@ func Test_Problem566(t *testing.T) { qs := []question566{ - question566{ - para566{[][]int{[]int{1, 2}, []int{3, 4}}, 1, 4}, - ans566{[][]int{[]int{1, 2, 3, 4}}}, + { + para566{[][]int{{1, 2}, {3, 4}}, 1, 4}, + ans566{[][]int{{1, 2, 3, 4}}}, }, - question566{ - para566{[][]int{[]int{1, 2}, []int{3, 4}}, 2, 4}, - ans566{[][]int{[]int{1, 2}, []int{3, 4}}}, + { + para566{[][]int{{1, 2}, {3, 4}}, 2, 4}, + ans566{[][]int{{1, 2}, {3, 4}}}, }, } diff --git a/leetcode/0567.Permutation-in-String/567. Permutation in String_test.go b/leetcode/0567.Permutation-in-String/567. Permutation in String_test.go index f4c0abf9..ccef0995 100644 --- a/leetcode/0567.Permutation-in-String/567. Permutation in String_test.go +++ b/leetcode/0567.Permutation-in-String/567. Permutation in String_test.go @@ -27,27 +27,27 @@ func Test_Problem567(t *testing.T) { qs := []question567{ - question567{ + { para567{"ab", "abab"}, ans567{true}, }, - question567{ + { para567{"abc", "cbaebabacd"}, ans567{true}, }, - question567{ + { para567{"abc", ""}, ans567{false}, }, - question567{ + { para567{"abc", "abacbabc"}, ans567{true}, }, - question567{ + { para567{"ab", "eidboaoo"}, ans567{false}, }, diff --git a/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go b/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go index ec44000f..0270e357 100644 --- a/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go +++ b/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go @@ -29,22 +29,22 @@ func Test_Problem572(t *testing.T) { qs := []question572{ - question572{ + { para572{[]int{}, []int{}}, ans572{true}, }, - question572{ + { para572{[]int{3, 4, 5, 1, 2}, []int{4, 1, 2}}, ans572{true}, }, - question572{ + { para572{[]int{1, 1}, []int{1}}, ans572{true}, }, - question572{ + { para572{[]int{1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, 2}, []int{1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, 2}}, ans572{true}, }, diff --git a/leetcode/0575.Distribute-Candies/575. Distribute Candies_test.go b/leetcode/0575.Distribute-Candies/575. Distribute Candies_test.go index 1109b89c..3f223fa0 100644 --- a/leetcode/0575.Distribute-Candies/575. Distribute Candies_test.go +++ b/leetcode/0575.Distribute-Candies/575. Distribute Candies_test.go @@ -26,12 +26,12 @@ func Test_Problem575(t *testing.T) { qs := []question575{ - question575{ + { para575{[]int{1, 1, 2, 2, 3, 3}}, ans575{3}, }, - question575{ + { para575{[]int{1, 1, 2, 3}}, ans575{2}, }, diff --git a/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go b/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go index 29ae7f5b..3c777d0d 100644 --- a/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go +++ b/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go @@ -26,7 +26,7 @@ func Test_Problem594(t *testing.T) { qs := []question594{ - question594{ + { para594{[]int{1, 3, 2, 2, 5, 2, 3, 7}}, ans594{5}, }, diff --git a/leetcode/0598.Range-Addition-II/598. Range Addition II_test.go b/leetcode/0598.Range-Addition-II/598. Range Addition II_test.go index 0800f5f9..f7be9b0d 100644 --- a/leetcode/0598.Range-Addition-II/598. Range Addition II_test.go +++ b/leetcode/0598.Range-Addition-II/598. Range Addition II_test.go @@ -28,8 +28,8 @@ func Test_Problem598(t *testing.T) { qs := []question598{ - question598{ - para598{3, 3, [][]int{[]int{2, 2}, []int{3, 3}}}, + { + para598{3, 3, [][]int{{2, 2}, {3, 3}}}, ans598{4}, }, } diff --git a/leetcode/0599.Minimum-Index-Sum-of-Two-Lists/599. Minimum Index Sum of Two Lists_test.go b/leetcode/0599.Minimum-Index-Sum-of-Two-Lists/599. Minimum Index Sum of Two Lists_test.go index 9554de91..a702a9ce 100644 --- a/leetcode/0599.Minimum-Index-Sum-of-Two-Lists/599. Minimum Index Sum of Two Lists_test.go +++ b/leetcode/0599.Minimum-Index-Sum-of-Two-Lists/599. Minimum Index Sum of Two Lists_test.go @@ -27,12 +27,12 @@ func Test_Problem599(t *testing.T) { qs := []question599{ - question599{ + { para599{[]string{"Shogun", "Tapioca Express", "Burger King", "KFC"}, []string{"Piatti", "The Grill at Torrey Pines", "Hungry Hunter Steakhouse", "Shogun"}}, ans599{[]string{"Shogun"}}, }, - question599{ + { para599{[]string{"Shogun", "Tapioca Express", "Burger King", "KFC"}, []string{"KFC", "Shogun", "Burger King"}}, ans599{[]string{"Shogun"}}, }, diff --git a/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go b/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go index 46f04daf..a73a836d 100644 --- a/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go +++ b/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go @@ -26,47 +26,47 @@ func Test_Problem628(t *testing.T) { qs := []question628{ - question628{ + { para628{[]int{3, -1, 4}}, ans628{-12}, }, - question628{ + { para628{[]int{1, 2}}, ans628{2}, }, - question628{ + { para628{[]int{1, 2, 3}}, ans628{6}, }, - question628{ + { para628{[]int{1, 2, 3, 4}}, ans628{24}, }, - question628{ + { para628{[]int{-2}}, ans628{-2}, }, - question628{ + { para628{[]int{0}}, ans628{0}, }, - question628{ + { para628{[]int{2, 3, -2, 4}}, ans628{-24}, }, - question628{ + { para628{[]int{-2, 0, -1}}, ans628{0}, }, - question628{ + { para628{[]int{-2, 0, -1, 2, 3, 1, 10}}, ans628{60}, }, diff --git a/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists_test.go b/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists_test.go index 045b7b3f..99d40b72 100644 --- a/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists_test.go +++ b/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists_test.go @@ -26,8 +26,8 @@ func Test_Problem632(t *testing.T) { qs := []question632{ - question632{ - para632{[][]int{[]int{4, 10, 15, 24, 26}, []int{0, 9, 12, 20}, []int{5, 18, 22, 30}}}, + { + para632{[][]int{{4, 10, 15, 24, 26}, {0, 9, 12, 20}, {5, 18, 22, 30}}}, ans632{[]int{20, 24}}, }, } diff --git a/leetcode/0633.Sum-of-Square-Numbers/633. Sum of Square Numbers_test.go b/leetcode/0633.Sum-of-Square-Numbers/633. Sum of Square Numbers_test.go index aebd61c2..36a6e3d6 100644 --- a/leetcode/0633.Sum-of-Square-Numbers/633. Sum of Square Numbers_test.go +++ b/leetcode/0633.Sum-of-Square-Numbers/633. Sum of Square Numbers_test.go @@ -26,37 +26,37 @@ func Test_Problem633(t *testing.T) { qs := []question633{ - question633{ + { para633{1}, ans633{true}, }, - question633{ + { para633{2}, ans633{true}, }, - question633{ + { para633{3}, ans633{false}, }, - question633{ + { para633{4}, ans633{true}, }, - question633{ + { para633{5}, ans633{true}, }, - question633{ + { para633{6}, ans633{false}, }, - question633{ + { para633{104976}, ans633{true}, }, diff --git a/leetcode/0636.Exclusive-Time-of-Functions/636. Exclusive Time of Functions_test.go b/leetcode/0636.Exclusive-Time-of-Functions/636. Exclusive Time of Functions_test.go index ea9db581..63be5715 100644 --- a/leetcode/0636.Exclusive-Time-of-Functions/636. Exclusive Time of Functions_test.go +++ b/leetcode/0636.Exclusive-Time-of-Functions/636. Exclusive Time of Functions_test.go @@ -27,17 +27,17 @@ func Test_Problem636(t *testing.T) { qs := []question636{ - question636{ + { para636{2, []string{"0:start:0", "0:start:2", "0:end:5", "1:start:7", "1:end:7", "0:end:8"}}, ans636{[]int{8, 1}}, }, - question636{ + { para636{2, []string{"0:start:0", "0:start:2", "0:end:5", "1:start:6", "1:end:6", "0:end:7"}}, ans636{[]int{7, 1}}, }, - question636{ + { para636{2, []string{"0:start:0", "1:start:2", "1:end:5", "0:end:6"}}, ans636{[]int{3, 4}}, }, diff --git a/leetcode/0637.Average-of-Levels-in-Binary-Tree/637. Average of Levels in Binary Tree_test.go b/leetcode/0637.Average-of-Levels-in-Binary-Tree/637. Average of Levels in Binary Tree_test.go index da4bfb21..44407297 100644 --- a/leetcode/0637.Average-of-Levels-in-Binary-Tree/637. Average of Levels in Binary Tree_test.go +++ b/leetcode/0637.Average-of-Levels-in-Binary-Tree/637. Average of Levels in Binary Tree_test.go @@ -28,19 +28,19 @@ func Test_Problem637(t *testing.T) { qs := []question637{ - question637{ + { para637{[]int{}}, ans637{[][]int{}}, }, - question637{ + { para637{[]int{1}}, - ans637{[][]int{[]int{1}}}, + ans637{[][]int{{1}}}, }, - question637{ + { para637{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, - ans637{[][]int{[]int{3}, []int{9, 20}, []int{15, 7}}}, + ans637{[][]int{{3}, {9, 20}, {15, 7}}}, }, } diff --git a/leetcode/0638.Shopping-Offers/638. Shopping Offers_test.go b/leetcode/0638.Shopping-Offers/638. Shopping Offers_test.go index 5ac44d3a..1bbd3ba1 100644 --- a/leetcode/0638.Shopping-Offers/638. Shopping Offers_test.go +++ b/leetcode/0638.Shopping-Offers/638. Shopping Offers_test.go @@ -28,13 +28,13 @@ func Test_Problem638(t *testing.T) { qs := []question638{ - question638{ - para638{[]int{2, 5}, [][]int{[]int{3, 0, 5}, []int{1, 2, 10}}, []int{3, 2}}, + { + para638{[]int{2, 5}, [][]int{{3, 0, 5}, {1, 2, 10}}, []int{3, 2}}, ans638{14}, }, - question638{ - para638{[]int{2, 3, 4}, [][]int{[]int{1, 1, 0, 4}, []int{2, 2, 1, 9}}, []int{1, 2, 1}}, + { + para638{[]int{2, 3, 4}, [][]int{{1, 1, 0, 4}, {2, 2, 1, 9}}, []int{1, 2, 1}}, ans638{11}, }, } diff --git a/leetcode/0645.Set-Mismatch/645. Set Mismatch_test.go b/leetcode/0645.Set-Mismatch/645. Set Mismatch_test.go index da842d64..2c28b43a 100644 --- a/leetcode/0645.Set-Mismatch/645. Set Mismatch_test.go +++ b/leetcode/0645.Set-Mismatch/645. Set Mismatch_test.go @@ -26,7 +26,7 @@ func Test_Problem645(t *testing.T) { qs := []question645{ - question645{ + { para645{[]int{1, 2, 2, 4}}, ans645{[]int{2, 3}}, }, diff --git a/leetcode/0648.Replace-Words/648. Replace Words_test.go b/leetcode/0648.Replace-Words/648. Replace Words_test.go index f9272e0e..998ae06c 100644 --- a/leetcode/0648.Replace-Words/648. Replace Words_test.go +++ b/leetcode/0648.Replace-Words/648. Replace Words_test.go @@ -27,7 +27,7 @@ func Test_Problem648(t *testing.T) { qs := []question648{ - question648{ + { para648{[]string{"cat", "bat", "rat"}, "the cattle was rattled by the battery"}, ans648{"the cat was rat by the bat"}, }, diff --git a/leetcode/0653.Two-Sum-IV---Input-is-a-BST/653. Two Sum IV - Input is a BST_test.go b/leetcode/0653.Two-Sum-IV---Input-is-a-BST/653. Two Sum IV - Input is a BST_test.go index dd82f53d..ced539c9 100644 --- a/leetcode/0653.Two-Sum-IV---Input-is-a-BST/653. Two Sum IV - Input is a BST_test.go +++ b/leetcode/0653.Two-Sum-IV---Input-is-a-BST/653. Two Sum IV - Input is a BST_test.go @@ -29,22 +29,22 @@ func Test_Problem653(t *testing.T) { qs := []question653{ - question653{ + { para653{[]int{}, 0}, ans653{false}, }, - question653{ + { para653{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}, 29}, ans653{true}, }, - question653{ + { para653{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, 5}, 9}, ans653{true}, }, - question653{ + { para653{[]int{1, 2, 3, 4, structures.NULL, 5}, 4}, ans653{true}, }, diff --git a/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go b/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go index ce6775ec..790d515e 100644 --- a/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go +++ b/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go @@ -28,12 +28,12 @@ func Test_Problem658(t *testing.T) { qs := []question658{ - question658{ + { para658{[]int{1, 2, 3, 4, 5}, 4, 3}, ans658{[]int{1, 2, 3, 4}}, }, - question658{ + { para658{[]int{1, 2, 3, 4, 5}, 4, -1}, ans658{[]int{1, 2, 3, 4}}, }, diff --git a/leetcode/0661.Image-Smoother/661. Image Smoother_test.go b/leetcode/0661.Image-Smoother/661. Image Smoother_test.go index f15ecdfd..0fa3a52f 100644 --- a/leetcode/0661.Image-Smoother/661. Image Smoother_test.go +++ b/leetcode/0661.Image-Smoother/661. Image Smoother_test.go @@ -26,19 +26,19 @@ func Test_Problem661(t *testing.T) { qs := []question661{ - question661{ - para661{[][]int{[]int{1, 1, 1}, []int{1, 1, 2}}}, - ans661{[][]int{[]int{1, 1, 1}, []int{1, 1, 1}}}, + { + para661{[][]int{{1, 1, 1}, {1, 1, 2}}}, + ans661{[][]int{{1, 1, 1}, {1, 1, 1}}}, }, - question661{ - para661{[][]int{[]int{1, 1, 1}, []int{1, 1, 2}, []int{1, 1, 1}}}, - ans661{[][]int{[]int{1, 1, 1}, []int{1, 1, 1}, []int{1, 1, 1}}}, + { + para661{[][]int{{1, 1, 1}, {1, 1, 2}, {1, 1, 1}}}, + ans661{[][]int{{1, 1, 1}, {1, 1, 1}, {1, 1, 1}}}, }, - question661{ - para661{[][]int{[]int{1, 1, 1}, []int{1, 0, 1}, []int{1, 1, 1}}}, - ans661{[][]int{[]int{0, 0, 0}, []int{0, 0, 0}, []int{0, 0, 0}}}, + { + para661{[][]int{{1, 1, 1}, {1, 0, 1}, {1, 1, 1}}}, + ans661{[][]int{{0, 0, 0}, {0, 0, 0}, {0, 0, 0}}}, }, } diff --git a/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree_test.go b/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree_test.go index a4b49d0a..decdffcb 100644 --- a/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree_test.go +++ b/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree_test.go @@ -28,27 +28,27 @@ func Test_Problem662(t *testing.T) { qs := []question662{ - question662{ + { para662{[]int{1, 1, 1, 1, 1, 1, 1, structures.NULL, structures.NULL, structures.NULL, 1, structures.NULL, structures.NULL, structures.NULL, structures.NULL, 2, 2, 2, 2, 2, 2, 2, structures.NULL, 2, structures.NULL, structures.NULL, 2, structures.NULL, 2}}, ans662{8}, }, - question662{ + { para662{[]int{1, 1, 1, 1, structures.NULL, structures.NULL, 1, 1, structures.NULL, structures.NULL, 1}}, ans662{8}, }, - question662{ + { para662{[]int{}}, ans662{0}, }, - question662{ + { para662{[]int{1}}, ans662{1}, }, - question662{ + { para662{[]int{1, 3, 2, 5, 3, structures.NULL, 9}}, ans662{4}, }, diff --git a/leetcode/0668.Kth-Smallest-Number-in-Multiplication-Table/668. Kth Smallest Number in Multiplication Table_test.go b/leetcode/0668.Kth-Smallest-Number-in-Multiplication-Table/668. Kth Smallest Number in Multiplication Table_test.go index 8285b611..7be66235 100644 --- a/leetcode/0668.Kth-Smallest-Number-in-Multiplication-Table/668. Kth Smallest Number in Multiplication Table_test.go +++ b/leetcode/0668.Kth-Smallest-Number-in-Multiplication-Table/668. Kth Smallest Number in Multiplication Table_test.go @@ -28,27 +28,27 @@ func Test_Problem668(t *testing.T) { qs := []question668{ - question668{ + { para668{3, 3, 5}, ans668{3}, }, - question668{ + { para668{2, 3, 6}, ans668{6}, }, - question668{ + { para668{1, 3, 2}, ans668{2}, }, - question668{ + { para668{42, 34, 401}, ans668{126}, }, - question668{ + { para668{7341, 13535, 12330027}, ans668{2673783}, }, diff --git a/leetcode/0682.Baseball-Game/682. Baseball Game_test.go b/leetcode/0682.Baseball-Game/682. Baseball Game_test.go index a5dac7d8..ce271aca 100644 --- a/leetcode/0682.Baseball-Game/682. Baseball Game_test.go +++ b/leetcode/0682.Baseball-Game/682. Baseball Game_test.go @@ -26,12 +26,12 @@ func Test_Problem682(t *testing.T) { qs := []question682{ - question682{ + { para682{[]string{"5", "2", "C", "D", "+"}}, ans682{30}, }, - question682{ + { para682{[]string{"5", "-2", "4", "C", "D", "9", "+", "+"}}, ans682{27}, }, diff --git a/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go b/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go index 2e30735d..f5e2f711 100644 --- a/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go +++ b/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go @@ -26,13 +26,13 @@ func Test_Problem684(t *testing.T) { qs := []question684{ - question684{ - para684{[][]int{[]int{1, 2}, []int{1, 3}, []int{2, 3}}}, + { + para684{[][]int{{1, 2}, {1, 3}, {2, 3}}}, ans684{[]int{2, 3}}, }, - question684{ - para684{[][]int{[]int{1, 2}, []int{2, 3}, []int{3, 4}, []int{1, 4}, []int{1, 5}}}, + { + para684{[][]int{{1, 2}, {2, 3}, {3, 4}, {1, 4}, {1, 5}}}, ans684{[]int{1, 4}}, }, } diff --git a/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go b/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go index 96a4ff22..4abb94ea 100644 --- a/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go +++ b/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go @@ -26,28 +26,28 @@ func Test_Problem685(t *testing.T) { qs := []question685{ - question685{ - para685{[][]int{[]int{3, 5}, []int{1, 3}, []int{2, 1}, []int{5, 4}, []int{2, 3}}}, + { + para685{[][]int{{3, 5}, {1, 3}, {2, 1}, {5, 4}, {2, 3}}}, ans685{[]int{2, 3}}, }, - question685{ - para685{[][]int{[]int{4, 2}, []int{1, 5}, []int{5, 2}, []int{5, 3}, []int{2, 4}}}, + { + para685{[][]int{{4, 2}, {1, 5}, {5, 2}, {5, 3}, {2, 4}}}, ans685{[]int{4, 2}}, }, - question685{ - para685{[][]int{[]int{1, 2}, []int{1, 3}, []int{2, 3}}}, + { + para685{[][]int{{1, 2}, {1, 3}, {2, 3}}}, ans685{[]int{2, 3}}, }, - question685{ - para685{[][]int{[]int{1, 2}, []int{2, 3}, []int{3, 4}, []int{1, 4}, []int{1, 5}}}, + { + para685{[][]int{{1, 2}, {2, 3}, {3, 4}, {1, 4}, {1, 5}}}, ans685{[]int{1, 4}}, }, - question685{ - para685{[][]int{[]int{2, 1}, []int{3, 1}, []int{4, 2}, []int{1, 4}}}, + { + para685{[][]int{{2, 1}, {3, 1}, {4, 2}, {1, 4}}}, ans685{[]int{2, 1}}, }, } diff --git a/leetcode/0693.Binary-Number-with-Alternating-Bits/693. Binary Number with Alternating Bits_test.go b/leetcode/0693.Binary-Number-with-Alternating-Bits/693. Binary Number with Alternating Bits_test.go index 321e3ca2..40a10bb2 100644 --- a/leetcode/0693.Binary-Number-with-Alternating-Bits/693. Binary Number with Alternating Bits_test.go +++ b/leetcode/0693.Binary-Number-with-Alternating-Bits/693. Binary Number with Alternating Bits_test.go @@ -26,22 +26,22 @@ func Test_Problem693(t *testing.T) { qs := []question693{ - question693{ + { para693{5}, ans693{true}, }, - question693{ + { para693{7}, ans693{false}, }, - question693{ + { para693{11}, ans693{false}, }, - question693{ + { para693{10}, ans693{true}, }, diff --git a/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go b/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go index 2f372dbc..d19c7fd7 100644 --- a/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go +++ b/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func maxAreaOfIsland(grid [][]int) int { diff --git a/leetcode/0695.Max-Area-of-Island/695. Max Area of Island_test.go b/leetcode/0695.Max-Area-of-Island/695. Max Area of Island_test.go index f7373b55..9bfea727 100644 --- a/leetcode/0695.Max-Area-of-Island/695. Max Area of Island_test.go +++ b/leetcode/0695.Max-Area-of-Island/695. Max Area of Island_test.go @@ -26,55 +26,55 @@ func Test_Problem695(t *testing.T) { qs := []question695{ - question695{ + { para695{[][]int{ - []int{1, 1, 1, 1, 0}, - []int{1, 1, 0, 1, 0}, - []int{1, 1, 0, 0, 0}, - []int{0, 0, 0, 0, 0}, + {1, 1, 1, 1, 0}, + {1, 1, 0, 1, 0}, + {1, 1, 0, 0, 0}, + {0, 0, 0, 0, 0}, }}, ans695{9}, }, - question695{ + { para695{[][]int{ - []int{1, 1, 0, 0, 0}, - []int{1, 1, 0, 0, 0}, - []int{0, 0, 1, 0, 0}, - []int{0, 0, 0, 1, 1}, + {1, 1, 0, 0, 0}, + {1, 1, 0, 0, 0}, + {0, 0, 1, 0, 0}, + {0, 0, 0, 1, 1}, }}, ans695{4}, }, - question695{ + { para695{[][]int{ - []int{1, 1, 1, 1, 1, 1, 1, 0}, - []int{1, 0, 0, 0, 0, 1, 1, 0}, - []int{1, 0, 1, 0, 1, 1, 1, 0}, - []int{1, 0, 0, 0, 0, 1, 0, 1}, - []int{1, 1, 1, 1, 1, 1, 1, 0}, + {1, 1, 1, 1, 1, 1, 1, 0}, + {1, 0, 0, 0, 0, 1, 1, 0}, + {1, 0, 1, 0, 1, 1, 1, 0}, + {1, 0, 0, 0, 0, 1, 0, 1}, + {1, 1, 1, 1, 1, 1, 1, 0}, }}, ans695{23}, }, - question695{ + { para695{[][]int{ - []int{0, 0, 1, 0, 0}, - []int{0, 1, 0, 1, 0}, - []int{0, 1, 1, 1, 0}, + {0, 0, 1, 0, 0}, + {0, 1, 0, 1, 0}, + {0, 1, 1, 1, 0}, }}, ans695{5}, }, - question695{ + { para695{[][]int{ - []int{1, 1, 1, 1, 1, 1, 1}, - []int{1, 0, 0, 0, 0, 0, 1}, - []int{1, 0, 1, 1, 1, 0, 1}, - []int{1, 0, 1, 0, 1, 0, 1}, - []int{1, 0, 1, 1, 1, 0, 1}, - []int{1, 0, 0, 0, 0, 0, 1}, - []int{1, 1, 1, 1, 1, 1, 1}, + {1, 1, 1, 1, 1, 1, 1}, + {1, 0, 0, 0, 0, 0, 1}, + {1, 0, 1, 1, 1, 0, 1}, + {1, 0, 1, 0, 1, 0, 1}, + {1, 0, 1, 1, 1, 0, 1}, + {1, 0, 0, 0, 0, 0, 1}, + {1, 1, 1, 1, 1, 1, 1}, }}, ans695{24}, }, diff --git a/leetcode/0697.Degree-of-an-Array/697. Degree of an Array_test.go b/leetcode/0697.Degree-of-an-Array/697. Degree of an Array_test.go index 57eb6c32..4f073002 100644 --- a/leetcode/0697.Degree-of-an-Array/697. Degree of an Array_test.go +++ b/leetcode/0697.Degree-of-an-Array/697. Degree of an Array_test.go @@ -26,27 +26,27 @@ func Test_Problem697(t *testing.T) { qs := []question697{ - question697{ + { para697{[]int{1, 2, 2, 3, 1}}, ans697{2}, }, - question697{ + { para697{[]int{1, 2, 2, 3, 1, 4, 2}}, ans697{6}, }, - question697{ + { para697{[]int{}}, ans697{0}, }, - question697{ + { para697{[]int{1, 1, 1, 1, 1}}, ans697{5}, }, - question697{ + { para697{[]int{1, 2, 2, 3, 1, 4, 2, 1, 2, 2, 3, 1, 4, 2}}, ans697{13}, }, diff --git a/leetcode/0699.Falling-Squares/699. Falling Squares_test.go b/leetcode/0699.Falling-Squares/699. Falling Squares_test.go index 7089d7e8..54e5aaea 100644 --- a/leetcode/0699.Falling-Squares/699. Falling Squares_test.go +++ b/leetcode/0699.Falling-Squares/699. Falling Squares_test.go @@ -26,23 +26,23 @@ func Test_Problem699(t *testing.T) { qs := []question699{ - question699{ - para699{[][]int{[]int{6, 1}, []int{9, 2}, []int{2, 4}}}, + { + para699{[][]int{{6, 1}, {9, 2}, {2, 4}}}, ans699{[]int{1, 2, 4}}, }, - question699{ - para699{[][]int{[]int{1, 2}, []int{1, 3}}}, + { + para699{[][]int{{1, 2}, {1, 3}}}, ans699{[]int{2, 5}}, }, - question699{ - para699{[][]int{[]int{1, 2}, []int{2, 3}, []int{6, 1}}}, + { + para699{[][]int{{1, 2}, {2, 3}, {6, 1}}}, ans699{[]int{2, 5, 5}}, }, - question699{ - para699{[][]int{[]int{100, 100}, []int{200, 100}}}, + { + para699{[][]int{{100, 100}, {200, 100}}}, ans699{[]int{100, 100}}, }, } diff --git a/leetcode/0704.Binary-Search/704. Binary Search_test.go b/leetcode/0704.Binary-Search/704. Binary Search_test.go index 85c06368..594327f2 100644 --- a/leetcode/0704.Binary-Search/704. Binary Search_test.go +++ b/leetcode/0704.Binary-Search/704. Binary Search_test.go @@ -27,12 +27,12 @@ func Test_Problem704(t *testing.T) { qs := []question704{ - question704{ + { para704{[]int{-1, 0, 3, 5, 9, 12}, 9}, ans704{4}, }, - question704{ + { para704{[]int{-1, 0, 3, 5, 9, 12}, 2}, ans704{-1}, }, diff --git a/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go b/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go index a1732ae4..ca633159 100644 --- a/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go +++ b/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go @@ -28,27 +28,27 @@ func Test_Problem710(t *testing.T) { qs := []question710{ - question710{ + { para710{1, []int{}, 3}, ans710{[]int{0, 0, 0}}, }, - question710{ + { para710{2, []int{}, 3}, ans710{[]int{1, 1, 1}}, }, - question710{ + { para710{3, []int{1}, 3}, ans710{[]int{0, 0, 2}}, }, - question710{ + { para710{4, []int{2}, 3}, ans710{[]int{1, 3, 1}}, }, - question710{ + { para710{10000000, []int{1, 9999, 999999, 99999, 100, 0}, 10}, ans710{[]int{400, 200, 300}}, }, diff --git a/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go b/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go index 5d879eb6..c6f8c865 100644 --- a/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go +++ b/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go @@ -27,12 +27,12 @@ func Test_Problem713(t *testing.T) { qs := []question713{ - question713{ + { para713{[]int{10, 5, 2, 6}, 100}, ans713{8}, }, - question713{ + { para713{[]int{10, 9, 10, 4, 3, 8, 3, 3, 6, 2, 10, 10, 9, 3}, 19}, ans713{18}, }, diff --git a/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee_test.go b/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee_test.go index 3bcdce3a..75c667b4 100644 --- a/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee_test.go +++ b/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee_test.go @@ -27,22 +27,22 @@ func Test_Problem714(t *testing.T) { qs := []question714{ - question714{ + { para714{[]int{}, 0}, ans714{0}, }, - question714{ + { para714{[]int{7, 1, 5, 3, 6, 4}, 0}, ans714{7}, }, - question714{ + { para714{[]int{7, 6, 4, 3, 1}, 0}, ans714{0}, }, - question714{ + { para714{[]int{1, 3, 2, 8, 4, 9}, 2}, ans714{8}, }, diff --git a/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters_test.go b/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters_test.go index ae26f48c..20228cc9 100644 --- a/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters_test.go +++ b/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters_test.go @@ -26,22 +26,22 @@ func Test_Problem717(t *testing.T) { qs := []question717{ - question717{ + { para717{[]int{1, 0, 0}}, ans717{true}, }, - question717{ + { para717{[]int{1, 1, 1, 0}}, ans717{false}, }, - question717{ + { para717{[]int{0, 1, 1, 1, 0, 0}}, ans717{true}, }, - question717{ + { para717{[]int{1, 1, 1, 1, 0}}, ans717{true}, }, diff --git a/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go b/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go index 60bdddc2..37ec1a04 100644 --- a/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go +++ b/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go @@ -27,22 +27,22 @@ func Test_Problem718(t *testing.T) { qs := []question718{ - question718{ + { para718{[]int{0, 0, 0, 0, 0}, []int{0, 0, 0, 0, 0}}, ans718{5}, }, - question718{ + { para718{[]int{1, 2, 3, 2, 1}, []int{3, 2, 1, 4, 7}}, ans718{3}, }, - question718{ + { para718{[]int{0, 0, 0, 0, 1}, []int{1, 0, 0, 0, 0}}, ans718{4}, }, - question718{ + { para718{[]int{0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, []int{0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0}}, ans718{59}, }, diff --git a/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance_test.go b/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance_test.go index 96885cd8..cf9ff58d 100644 --- a/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance_test.go +++ b/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance_test.go @@ -27,27 +27,27 @@ func Test_Problem719(t *testing.T) { qs := []question719{ - question719{ + { para719{[]int{1, 3, 1}, 1}, ans719{0}, }, - question719{ + { para719{[]int{1, 1, 1}, 2}, ans719{0}, }, - question719{ + { para719{[]int{1, 6, 1}, 3}, ans719{5}, }, - question719{ + { para719{[]int{62, 100, 4}, 2}, ans719{58}, }, - question719{ + { para719{[]int{9, 10, 7, 10, 6, 1, 5, 4, 9, 8}, 18}, ans719{2}, }, diff --git a/leetcode/0720.Longest-Word-in-Dictionary/720. Longest Word in Dictionary_test.go b/leetcode/0720.Longest-Word-in-Dictionary/720. Longest Word in Dictionary_test.go index b018bcfa..0e63bb59 100644 --- a/leetcode/0720.Longest-Word-in-Dictionary/720. Longest Word in Dictionary_test.go +++ b/leetcode/0720.Longest-Word-in-Dictionary/720. Longest Word in Dictionary_test.go @@ -26,12 +26,12 @@ func Test_Problem720(t *testing.T) { qs := []question720{ - question720{ + { para720{[]string{"w", "wo", "wor", "worl", "world"}}, ans720{"world"}, }, - question720{ + { para720{[]string{"a", "banana", "app", "appl", "ap", "apply", "apple"}}, ans720{"apple"}, }, diff --git a/leetcode/0721.Accounts-Merge/721. Accounts Merge_test.go b/leetcode/0721.Accounts-Merge/721. Accounts Merge_test.go index d0dd8bcd..40ed580d 100644 --- a/leetcode/0721.Accounts-Merge/721. Accounts Merge_test.go +++ b/leetcode/0721.Accounts-Merge/721. Accounts Merge_test.go @@ -26,38 +26,38 @@ func Test_Problem721(t *testing.T) { qs := []question721{ - question721{ - para721{[][]string{[]string{"John", "johnsmith@mail.com", "john00@mail.com"}, - []string{"John", "johnnybravo@mail.com"}, - []string{"John", "johnsmith@mail.com", "john_newyork@mail.com"}, - []string{"Mary", "mary@mail.com"}}}, - ans721{[][]string{[]string{"John", "john00@mail.com", "john_newyork@mail.com", "johnsmith@mail.com"}, - []string{"John", "johnnybravo@mail.com"}, - []string{"Mary", "mary@mail.com"}}}, + { + para721{[][]string{{"John", "johnsmith@mail.com", "john00@mail.com"}, + {"John", "johnnybravo@mail.com"}, + {"John", "johnsmith@mail.com", "john_newyork@mail.com"}, + {"Mary", "mary@mail.com"}}}, + ans721{[][]string{{"John", "john00@mail.com", "john_newyork@mail.com", "johnsmith@mail.com"}, + {"John", "johnnybravo@mail.com"}, + {"Mary", "mary@mail.com"}}}, }, - question721{ - para721{[][]string{[]string{"Alex", "Alex5@m.co", "Alex4@m.co", "Alex0@m.co"}, - []string{"Ethan", "Ethan3@m.co", "Ethan3@m.co", "Ethan0@m.co"}, - []string{"Kevin", "Kevin4@m.co", "Kevin2@m.co", "Kevin2@m.co"}, - []string{"Gabe", "Gabe0@m.co", "Gabe3@m.co", "Gabe2@m.co"}, - []string{"Gabe", "Gabe3@m.co", "Gabe4@m.co", "Gabe2@m.co"}}}, - ans721{[][]string{[]string{"Alex", "Alex0@m.co", "Alex4@m.co", "Alex5@m.co"}, - []string{"Ethan", "Ethan0@m.co", "Ethan3@m.co"}, - []string{"Gabe", "Gabe0@m.co", "Gabe2@m.co", "Gabe3@m.co", "Gabe4@m.co"}, - []string{"Kevin", "Kevin2@m.co", "Kevin4@m.co"}}}, + { + para721{[][]string{{"Alex", "Alex5@m.co", "Alex4@m.co", "Alex0@m.co"}, + {"Ethan", "Ethan3@m.co", "Ethan3@m.co", "Ethan0@m.co"}, + {"Kevin", "Kevin4@m.co", "Kevin2@m.co", "Kevin2@m.co"}, + {"Gabe", "Gabe0@m.co", "Gabe3@m.co", "Gabe2@m.co"}, + {"Gabe", "Gabe3@m.co", "Gabe4@m.co", "Gabe2@m.co"}}}, + ans721{[][]string{{"Alex", "Alex0@m.co", "Alex4@m.co", "Alex5@m.co"}, + {"Ethan", "Ethan0@m.co", "Ethan3@m.co"}, + {"Gabe", "Gabe0@m.co", "Gabe2@m.co", "Gabe3@m.co", "Gabe4@m.co"}, + {"Kevin", "Kevin2@m.co", "Kevin4@m.co"}}}, }, - question721{ - para721{[][]string{[]string{"David", "David0@m.co", "David4@m.co", "David3@m.co"}, - []string{"David", "David5@m.co", "David5@m.co", "David0@m.co"}, - []string{"David", "David1@m.co", "David4@m.co", "David0@m.co"}, - []string{"David", "David0@m.co", "David1@m.co", "David3@m.co"}, - []string{"David", "David4@m.co", "David1@m.co", "David3@m.co"}}}, - ans721{[][]string{[]string{"David", "David0@m.co", "David1@m.co", "David3@m.co", "David4@m.co", "David5@m.co"}}}, + { + para721{[][]string{{"David", "David0@m.co", "David4@m.co", "David3@m.co"}, + {"David", "David5@m.co", "David5@m.co", "David0@m.co"}, + {"David", "David1@m.co", "David4@m.co", "David0@m.co"}, + {"David", "David0@m.co", "David1@m.co", "David3@m.co"}, + {"David", "David4@m.co", "David1@m.co", "David3@m.co"}}}, + ans721{[][]string{{"David", "David0@m.co", "David1@m.co", "David3@m.co", "David4@m.co", "David5@m.co"}}}, }, - question721{ + { para721{[][]string{}}, ans721{[][]string{}}, }, diff --git a/leetcode/0724.Find-Pivot-Index/724. Find Pivot Index_test.go b/leetcode/0724.Find-Pivot-Index/724. Find Pivot Index_test.go index f1ed6fd4..6c89385a 100644 --- a/leetcode/0724.Find-Pivot-Index/724. Find Pivot Index_test.go +++ b/leetcode/0724.Find-Pivot-Index/724. Find Pivot Index_test.go @@ -26,32 +26,32 @@ func Test_Problem724(t *testing.T) { qs := []question724{ - question724{ + { para724{[]int{1, 7, 3, 6, 5, 6}}, ans724{3}, }, - question724{ + { para724{[]int{1, 2, 3}}, ans724{-1}, }, - question724{ + { para724{[]int{-1, -1, -1, -1, -1, -1}}, ans724{-1}, }, - question724{ + { para724{[]int{-1, -1, -1, -1, -1, 0}}, ans724{2}, }, - question724{ + { para724{[]int{1}}, ans724{0}, }, - question724{ + { para724{[]int{}}, ans724{-1}, }, diff --git a/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts.go b/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts.go index 167b4ae9..9a17de21 100644 --- a/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts.go +++ b/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts.go @@ -27,9 +27,8 @@ func splitListToParts(root *ListNode, k int) []*ListNode { length := getLength(root) splitNum := length / k lengNum := length % k - cur := root - head := root - pre := root + cur, head := root, root + var pre *ListNode fmt.Printf("总长度 %v, 分 %v 组, 前面 %v 组长度为 %v, 剩余 %v 组，每组 %v\n", length, k, lengNum, splitNum+1, k-lengNum, splitNum) if splitNum == 0 { for i := 0; i < k; i++ { diff --git a/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts_test.go b/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts_test.go index 233e0978..45642316 100644 --- a/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts_test.go +++ b/leetcode/0725.Split-Linked-List-in-Parts/725. Split Linked List in Parts_test.go @@ -29,42 +29,42 @@ func Test_Problem725(t *testing.T) { qs := []question725{ - question725{ + { para725{[]int{1, 2, 3, 4, 5}, 7}, ans725{[]int{1, 2, 3, 4, 5, 0, 0}}, }, - question725{ + { para725{[]int{1, 2, 3, 4, 5, 6, 7, 8, 9, 10}, 3}, ans725{[]int{1, 2, 3, 4, 5, 6, 7, 8, 9, 10}}, }, - question725{ + { para725{[]int{1, 1, 1, 1, 1}, 1}, ans725{[]int{1, 1, 1, 1, 1}}, }, - question725{ + { para725{[]int{}, 3}, ans725{[]int{}}, }, - question725{ + { para725{[]int{1, 2, 3, 4, 5}, 5}, ans725{[]int{1, 2, 3, 4}}, }, - question725{ + { para725{[]int{}, 5}, ans725{[]int{}}, }, - question725{ + { para725{[]int{1, 2, 3, 4, 5}, 10}, ans725{[]int{1, 2, 3, 4, 5}}, }, - question725{ + { para725{[]int{1}, 1}, ans725{[]int{}}, }, diff --git a/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go b/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go index d65bac31..a0ca4e59 100644 --- a/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go +++ b/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go @@ -26,22 +26,22 @@ func Test_Problem726(t *testing.T) { qs := []question726{ - question726{ + { para726{"H200P"}, ans726{"H200P"}, }, - question726{ + { para726{"H2O"}, ans726{"H2O"}, }, - question726{ + { para726{"Mg(OH)2"}, ans726{"H2MgO2"}, }, - question726{ + { para726{"K4(ON(SO3)2)2"}, ans726{"K4N2O14S4"}, }, diff --git a/leetcode/0733.Flood-Fill/733. Flood Fill.go b/leetcode/0733.Flood-Fill/733. Flood Fill.go index 38bd3bef..9cc8fe63 100644 --- a/leetcode/0733.Flood-Fill/733. Flood Fill.go +++ b/leetcode/0733.Flood-Fill/733. Flood Fill.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func floodFill(image [][]int, sr int, sc int, newColor int) [][]int { diff --git a/leetcode/0733.Flood-Fill/733. Flood Fill_test.go b/leetcode/0733.Flood-Fill/733. Flood Fill_test.go index 3f1c706c..13d0e05c 100644 --- a/leetcode/0733.Flood-Fill/733. Flood Fill_test.go +++ b/leetcode/0733.Flood-Fill/733. Flood Fill_test.go @@ -29,16 +29,16 @@ func Test_Problem733(t *testing.T) { qs := []question733{ - question733{ + { para733{[][]int{ - []int{1, 1, 1}, - []int{1, 1, 0}, - []int{1, 0, 1}, + {1, 1, 1}, + {1, 1, 0}, + {1, 0, 1}, }, 1, 1, 2}, ans733{[][]int{ - []int{2, 2, 2}, - []int{2, 2, 0}, - []int{2, 0, 1}, + {2, 2, 2}, + {2, 2, 0}, + {2, 0, 1}, }}, }, } diff --git a/leetcode/0735.Asteroid-Collision/735. Asteroid Collision_test.go b/leetcode/0735.Asteroid-Collision/735. Asteroid Collision_test.go index 322e5240..e37bbb91 100644 --- a/leetcode/0735.Asteroid-Collision/735. Asteroid Collision_test.go +++ b/leetcode/0735.Asteroid-Collision/735. Asteroid Collision_test.go @@ -26,32 +26,32 @@ func Test_Problem735(t *testing.T) { qs := []question735{ - question735{ + { para735{[]int{-1, -1, 1, -2}}, ans735{[]int{-1, -1, -2}}, }, - question735{ + { para735{[]int{5, 10, -5}}, ans735{[]int{5, 10}}, }, - question735{ + { para735{[]int{5, 8, -8}}, ans735{[]int{5}}, }, - question735{ + { para735{[]int{8, -8}}, ans735{[]int{}}, }, - question735{ + { para735{[]int{10, 2, -5}}, ans735{[]int{10}}, }, - question735{ + { para735{[]int{-2, -1, 1, 2}}, ans735{[]int{-2, -1, 1, 2}}, }, diff --git a/leetcode/0739.Daily-Temperatures/739. Daily Temperatures_test.go b/leetcode/0739.Daily-Temperatures/739. Daily Temperatures_test.go index 2171bca3..5266d620 100644 --- a/leetcode/0739.Daily-Temperatures/739. Daily Temperatures_test.go +++ b/leetcode/0739.Daily-Temperatures/739. Daily Temperatures_test.go @@ -26,7 +26,7 @@ func Test_Problem739(t *testing.T) { qs := []question739{ - question739{ + { para739{[]int{73, 74, 75, 71, 69, 72, 76, 73}}, ans739{[]int{1, 1, 4, 2, 1, 1, 0, 0}}, }, diff --git a/leetcode/0744.Find-Smallest-Letter-Greater-Than-Target/744. Find Smallest Letter Greater Than Target_test.go b/leetcode/0744.Find-Smallest-Letter-Greater-Than-Target/744. Find Smallest Letter Greater Than Target_test.go index 87060307..6592bad0 100644 --- a/leetcode/0744.Find-Smallest-Letter-Greater-Than-Target/744. Find Smallest Letter Greater Than Target_test.go +++ b/leetcode/0744.Find-Smallest-Letter-Greater-Than-Target/744. Find Smallest Letter Greater Than Target_test.go @@ -27,32 +27,32 @@ func Test_Problem744(t *testing.T) { qs := []question744{ - question744{ + { para744{[]byte{'c', 'f', 'j'}, 'a'}, ans744{'c'}, }, - question744{ + { para744{[]byte{'c', 'f', 'j'}, 'c'}, ans744{'f'}, }, - question744{ + { para744{[]byte{'c', 'f', 'j'}, 'd'}, ans744{'f'}, }, - question744{ + { para744{[]byte{'c', 'f', 'j'}, 'g'}, ans744{'j'}, }, - question744{ + { para744{[]byte{'c', 'f', 'j'}, 'j'}, ans744{'c'}, }, - question744{ + { para744{[]byte{'c', 'f', 'j'}, 'k'}, ans744{'c'}, }, diff --git a/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs_test.go b/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs_test.go index 59a0bd98..e09c5efe 100644 --- a/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs_test.go +++ b/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs_test.go @@ -26,12 +26,12 @@ func Test_Problem746(t *testing.T) { qs := []question746{ - question746{ + { para746{[]int{10, 15, 20}}, ans746{15}, }, - question746{ + { para746{[]int{1, 100, 1, 1, 1, 100, 1, 1, 100, 1}}, ans746{6}, }, diff --git a/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word_test.go b/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word_test.go index 78292b82..32be3fa1 100644 --- a/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word_test.go +++ b/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word_test.go @@ -27,12 +27,12 @@ func Test_Problem748(t *testing.T) { qs := []question748{ - question748{ + { para748{"1s3 PSt", []string{"step", "steps", "stripe", "stepple"}}, ans748{"steps"}, }, - question748{ + { para748{"1s3 456", []string{"looks", "pest", "stew", "show"}}, ans748{"pest"}, }, diff --git a/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe_test.go b/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe_test.go index fb9fda24..169a8549 100644 --- a/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe_test.go +++ b/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe_test.go @@ -27,12 +27,12 @@ func Test_Problem753(t *testing.T) { qs := []question753{ - question753{ + { para753{1, 2}, ans753{"01"}, }, - question753{ + { para753{2, 2}, ans753{"00110"}, }, diff --git a/leetcode/0756.Pyramid-Transition-Matrix/756. Pyramid Transition Matrix_test.go b/leetcode/0756.Pyramid-Transition-Matrix/756. Pyramid Transition Matrix_test.go index 986885cf..a6684038 100644 --- a/leetcode/0756.Pyramid-Transition-Matrix/756. Pyramid Transition Matrix_test.go +++ b/leetcode/0756.Pyramid-Transition-Matrix/756. Pyramid Transition Matrix_test.go @@ -27,12 +27,12 @@ func Test_Problem756(t *testing.T) { qs := []question756{ - question756{ + { para756{"BCD", []string{"BCG", "CDE", "GEA", "FFF"}}, ans756{true}, }, - question756{ + { para756{"AABA", []string{"AAA", "AAB", "ABA", "ABB", "BAC"}}, ans756{false}, }, diff --git a/leetcode/0762.Prime-Number-of-Set-Bits-in-Binary-Representation/762. Prime Number of Set Bits in Binary Representation_test.go b/leetcode/0762.Prime-Number-of-Set-Bits-in-Binary-Representation/762. Prime Number of Set Bits in Binary Representation_test.go index a57f0c44..1c3c0de2 100644 --- a/leetcode/0762.Prime-Number-of-Set-Bits-in-Binary-Representation/762. Prime Number of Set Bits in Binary Representation_test.go +++ b/leetcode/0762.Prime-Number-of-Set-Bits-in-Binary-Representation/762. Prime Number of Set Bits in Binary Representation_test.go @@ -27,12 +27,12 @@ func Test_Problem762(t *testing.T) { qs := []question762{ - question762{ + { para762{6, 10}, ans762{4}, }, - question762{ + { para762{10, 15}, ans762{5}, }, diff --git a/leetcode/0763.Partition-Labels/763. Partition Labels_test.go b/leetcode/0763.Partition-Labels/763. Partition Labels_test.go index 3e258b90..8ac0c07e 100644 --- a/leetcode/0763.Partition-Labels/763. Partition Labels_test.go +++ b/leetcode/0763.Partition-Labels/763. Partition Labels_test.go @@ -26,7 +26,7 @@ func Test_Problem763(t *testing.T) { qs := []question763{ - question763{ + { para763{"ababcbacadefegdehijhklij"}, ans763{[]int{9, 7, 8}}, }, diff --git a/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go b/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go index 46cd1bef..fb0c7018 100644 --- a/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go +++ b/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go @@ -26,22 +26,22 @@ func Test_Problem765(t *testing.T) { qs := []question765{ - question765{ + { para765{[]int{0, 2, 1, 3}}, ans765{1}, }, - question765{ + { para765{[]int{3, 2, 0, 1}}, ans765{0}, }, - question765{ + { para765{[]int{3, 1, 4, 0, 2, 5}}, ans765{2}, }, - question765{ + { para765{[]int{10, 7, 4, 2, 3, 0, 9, 11, 1, 5, 6, 8}}, ans765{4}, }, diff --git a/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix_test.go b/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix_test.go index f32a915f..fa18cb75 100644 --- a/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix_test.go +++ b/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix_test.go @@ -26,13 +26,13 @@ func Test_Problem766(t *testing.T) { qs := []question766{ - question766{ - para766{[][]int{[]int{1, 2, 3, 4}, []int{5, 1, 2, 3}, []int{9, 5, 1, 2}}}, + { + para766{[][]int{{1, 2, 3, 4}, {5, 1, 2, 3}, {9, 5, 1, 2}}}, ans766{true}, }, - question766{ - para766{[][]int{[]int{1, 2}, []int{2, 2}}}, + { + para766{[][]int{{1, 2}, {2, 2}}}, ans766{false}, }, } diff --git a/leetcode/0767.Reorganize-String/767. Reorganize String_test.go b/leetcode/0767.Reorganize-String/767. Reorganize String_test.go index 7c67ee5f..ab8f52ec 100644 --- a/leetcode/0767.Reorganize-String/767. Reorganize String_test.go +++ b/leetcode/0767.Reorganize-String/767. Reorganize String_test.go @@ -25,12 +25,12 @@ type ans767 struct { func Test_Problem767(t *testing.T) { qs := []question767{ - question767{ + { para767{"aab"}, ans767{"aba"}, }, - question767{ + { para767{"aaab"}, ans767{""}, }, diff --git a/leetcode/0771.Jewels-and-Stones/771. Jewels and Stones_test.go b/leetcode/0771.Jewels-and-Stones/771. Jewels and Stones_test.go index b9dae4cb..8cdc308e 100644 --- a/leetcode/0771.Jewels-and-Stones/771. Jewels and Stones_test.go +++ b/leetcode/0771.Jewels-and-Stones/771. Jewels and Stones_test.go @@ -26,12 +26,12 @@ type ans771 struct { func Test_Problem771(t *testing.T) { qs := []question771{ - question771{ + { para771{"aA", "aAAbbbb"}, ans771{3}, }, - question771{ + { para771{"z", "ZZ"}, ans771{0}, }, diff --git a/leetcode/0778.Swim-in-Rising-Water/778. Swim in Rising Water_test.go b/leetcode/0778.Swim-in-Rising-Water/778. Swim in Rising Water_test.go index d78aeff2..6523d003 100644 --- a/leetcode/0778.Swim-in-Rising-Water/778. Swim in Rising Water_test.go +++ b/leetcode/0778.Swim-in-Rising-Water/778. Swim in Rising Water_test.go @@ -25,13 +25,13 @@ type ans778 struct { func Test_Problem778(t *testing.T) { qs := []question778{ - question778{ - para778{[][]int{[]int{0, 2}, []int{1, 3}}}, + { + para778{[][]int{{0, 2}, {1, 3}}}, ans778{3}, }, - question778{ - para778{[][]int{[]int{0, 1, 2, 3, 4}, []int{24, 23, 22, 21, 5}, []int{12, 13, 14, 15, 16}, []int{11, 17, 18, 19, 20}, []int{10, 9, 8, 7, 6}}}, + { + para778{[][]int{{0, 1, 2, 3, 4}, {24, 23, 22, 21, 5}, {12, 13, 14, 15, 16}, {11, 17, 18, 19, 20}, {10, 9, 8, 7, 6}}}, ans778{16}, }, } diff --git a/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest_test.go b/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest_test.go index f8c8bed1..093dd287 100644 --- a/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest_test.go +++ b/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest_test.go @@ -25,17 +25,17 @@ type ans781 struct { func Test_Problem781(t *testing.T) { qs := []question781{ - question781{ + { para781{[]int{1, 1, 2}}, ans781{5}, }, - question781{ + { para781{[]int{10, 10, 10}}, ans781{11}, }, - question781{ + { para781{[]int{}}, ans781{0}, }, diff --git a/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go b/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go index 5eb38516..9891c4e6 100644 --- a/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go +++ b/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go @@ -26,27 +26,27 @@ func Test_Problem784(t *testing.T) { qs := []question784{ - question784{ + { para784{"mQe"}, ans784{[]string{"mqe", "mqE", "mQe", "mQE", "Mqe", "MqE", "MQe", "MQE"}}, }, - question784{ + { para784{"C"}, ans784{[]string{"c", "C"}}, }, - question784{ + { para784{"a1b2"}, ans784{[]string{"a1b2", "a1B2", "A1b2", "A1B2"}}, }, - question784{ + { para784{"3z4"}, ans784{[]string{"3z4", "3Z4"}}, }, - question784{ + { para784{"12345"}, ans784{[]string{"12345"}}, }, diff --git a/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go b/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go index dbb27301..4fde3438 100644 --- a/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go +++ b/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go @@ -27,22 +27,22 @@ func Test_Problem786(t *testing.T) { qs := []question786{ - question786{ + { para786{[]int{1, 2, 3, 5}, 3}, ans786{[]int{2, 5}}, }, - question786{ + { para786{[]int{1, 7}, 1}, ans786{[]int{1, 7}}, }, - question786{ + { para786{[]int{1, 2}, 1}, ans786{[]int{1, 2}}, }, - question786{ + { para786{[]int{1, 2, 3, 5, 7}, 6}, ans786{[]int{3, 7}}, }, diff --git a/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go b/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go index ce55d208..de6ab01e 100644 --- a/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go +++ b/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go @@ -26,12 +26,12 @@ func Test_Problem793(t *testing.T) { qs := []question793{ - question793{ + { para793{0}, ans793{5}, }, - question793{ + { para793{5}, ans793{0}, }, diff --git a/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States_test.go b/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States_test.go index 230d2c4c..631e49d7 100644 --- a/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States_test.go +++ b/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States_test.go @@ -26,8 +26,8 @@ func Test_Problem802(t *testing.T) { qs := []question802{ - question802{ - para802{[][]int{[]int{1, 2}, []int{2, 3}, []int{5}, []int{0}, []int{5}, []int{}, []int{}}}, + { + para802{[][]int{{1, 2}, {2, 3}, {5}, {0}, {5}, {}, {}}}, ans802{[]int{2, 4, 5, 6}}, }, } diff --git a/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go b/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go index 6ec4f44f..879835c1 100644 --- a/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go +++ b/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go @@ -5,10 +5,10 @@ import ( ) var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func hitBricks(grid [][]int, hits [][]int) []int { diff --git a/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go b/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go index 35bfa3de..558e7c50 100644 --- a/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go +++ b/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go @@ -27,23 +27,23 @@ func Test_Problem803(t *testing.T) { qs := []question803{ - question803{ - para803{[][]int{[]int{1, 1, 1, 0, 1, 1, 1, 1}, []int{1, 0, 0, 0, 0, 1, 1, 1}, []int{1, 1, 1, 0, 0, 0, 1, 1}, []int{1, 1, 0, 0, 0, 0, 0, 0}, []int{1, 0, 0, 0, 0, 0, 0, 0}, []int{1, 0, 0, 0, 0, 0, 0, 0}}, - [][]int{[]int{4, 6}, []int{3, 0}, []int{2, 3}, []int{2, 6}, []int{4, 1}, []int{5, 2}, []int{2, 1}}}, + { + para803{[][]int{{1, 1, 1, 0, 1, 1, 1, 1}, {1, 0, 0, 0, 0, 1, 1, 1}, {1, 1, 1, 0, 0, 0, 1, 1}, {1, 1, 0, 0, 0, 0, 0, 0}, {1, 0, 0, 0, 0, 0, 0, 0}, {1, 0, 0, 0, 0, 0, 0, 0}}, + [][]int{{4, 6}, {3, 0}, {2, 3}, {2, 6}, {4, 1}, {5, 2}, {2, 1}}}, ans803{[]int{0, 2, 0, 0, 0, 0, 2}}, }, - question803{ - para803{[][]int{[]int{1, 0, 1}, []int{1, 1, 1}}, [][]int{[]int{0, 0}, []int{0, 2}, []int{1, 1}}}, + { + para803{[][]int{{1, 0, 1}, {1, 1, 1}}, [][]int{{0, 0}, {0, 2}, {1, 1}}}, ans803{[]int{0, 3, 0}}, }, - question803{ - para803{[][]int{[]int{1, 0, 0, 0}, []int{1, 1, 1, 0}}, [][]int{[]int{1, 0}}}, + { + para803{[][]int{{1, 0, 0, 0}, {1, 1, 1, 0}}, [][]int{{1, 0}}}, ans803{[]int{2}}, }, - question803{ - para803{[][]int{[]int{1, 0, 0, 0}, []int{1, 1, 0, 0}}, [][]int{[]int{1, 1}, []int{1, 0}}}, + { + para803{[][]int{{1, 0, 0, 0}, {1, 1, 0, 0}}, [][]int{{1, 1}, {1, 0}}}, ans803{[]int{0, 0}}, }, } diff --git a/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go b/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go index 5176905a..700e7d97 100644 --- a/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go +++ b/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go @@ -26,12 +26,12 @@ func Test_Problem811(t *testing.T) { qs := []question811{ - question811{ + { para811{[]string{"9001 discuss.leetcode.com"}}, ans811{[]string{"mqe", "mqE", "mQe", "mQE", "Mqe", "MqE", "MQe", "MQE"}}, }, - question811{ + { para811{[]string{"900 google.mail.com", "50 yahoo.com", "1 intel.mail.com", "5 wiki.org"}}, ans811{[]string{"901 mail.com", "50 yahoo.com", "900 google.mail.com", "5 wiki.org", "5 org", "1 intel.mail.com", "951 com"}}, }, diff --git a/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area_test.go b/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area_test.go index 8e461ca2..140980b0 100644 --- a/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area_test.go +++ b/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area_test.go @@ -26,8 +26,8 @@ func Test_Problem812(t *testing.T) { qs := []question812{ - question812{ - para812{[][]int{[]int{0, 0}, []int{0, 1}, []int{1, 0}, []int{0, 2}, []int{2, 0}}}, + { + para812{[][]int{{0, 0}, {0, 1}, {1, 0}, {0, 2}, {2, 0}}}, ans812{2.0}, }, } diff --git a/leetcode/0815.Bus-Routes/815. Bus Routes_test.go b/leetcode/0815.Bus-Routes/815. Bus Routes_test.go index 271d1370..5581144e 100644 --- a/leetcode/0815.Bus-Routes/815. Bus Routes_test.go +++ b/leetcode/0815.Bus-Routes/815. Bus Routes_test.go @@ -28,8 +28,8 @@ func Test_Problem815(t *testing.T) { qs := []question815{ - question815{ - para815{[][]int{[]int{1, 2, 7}, []int{3, 6, 7}}, 1, 6}, + { + para815{[][]int{{1, 2, 7}, {3, 6, 7}}, 1, 6}, ans815{2}, }, } diff --git a/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go b/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go index d33235bf..e1d35158 100644 --- a/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go +++ b/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go @@ -29,37 +29,37 @@ func Test_Problem817(t *testing.T) { qs := []question817{ - question817{ + { para817{[]int{0, 1, 2, 3}, []int{0, 1, 3}}, ans817{2}, }, - question817{ + { para817{[]int{1, 2, 3, 4}, []int{1, 2, 3, 4}}, ans817{1}, }, - question817{ + { para817{[]int{0, 1, 2, 3, 4}, []int{0, 3, 1, 4}}, ans817{2}, }, - question817{ + { para817{[]int{0, 1, 2}, []int{0, 2}}, ans817{2}, }, - question817{ + { para817{[]int{1, 2, 0, 4, 3}, []int{3, 4, 0, 2, 1}}, ans817{1}, }, - question817{ + { para817{[]int{0, 2, 4, 3, 1}, []int{3, 2, 4}}, ans817{1}, }, - question817{ + { para817{[]int{7, 5, 13, 3, 16, 11, 12, 0, 17, 1, 4, 15, 6, 14, 2, 19, 9, 10, 8, 18}, []int{8, 10, 3, 11, 17, 16, 7, 9, 5, 15, 13, 6}}, ans817{4}, }, diff --git a/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go b/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go index b9478810..c0e8265a 100644 --- a/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go +++ b/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go @@ -27,7 +27,7 @@ func Test_Problem819(t *testing.T) { qs := []question819{ - question819{ + { para819{"Bob hit a ball, the hit BALL flew far after it was hit.", []string{"hit"}}, ans819{"ball"}, }, diff --git a/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go b/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go index a7ab61d0..a89eb586 100644 --- a/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go +++ b/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go @@ -28,12 +28,12 @@ func Test_Problem826(t *testing.T) { qs := []question826{ - question826{ + { para826{[]int{2, 4, 6, 8, 10}, []int{10, 20, 30, 40, 50}, []int{4, 5, 6, 7}}, ans826{100}, }, - question826{ + { para826{[]int{85, 47, 57}, []int{24, 66, 99}, []int{40, 25, 25}}, ans826{0}, }, diff --git a/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String.go b/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String.go index 92dd5f76..9129b8b4 100644 --- a/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String.go +++ b/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String.go @@ -21,10 +21,9 @@ func uniqueLetterString1(S string) int { if len(S) == 0 { return 0 } - letterMap := map[byte]int{} res, mod := 0, 1000000007 for i := 0; i < len(S); i++ { - letterMap = map[byte]int{} + letterMap := map[byte]int{} for j := i; j < len(S); j++ { letterMap[S[j]]++ tmp := 0 diff --git a/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String_test.go b/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String_test.go index 15a21e40..620c32ba 100644 --- a/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String_test.go +++ b/leetcode/0828.COPYRIGHT-PROBLEM-XXX/828. Unique Letter String_test.go @@ -26,22 +26,22 @@ func Test_Problem828(t *testing.T) { qs := []question828{ - question828{ + { para828{"BABABBABAA"}, ans828{35}, }, - question828{ + { para828{"ABC"}, ans828{10}, }, - question828{ + { para828{"ABA"}, ans828{8}, }, - question828{ + { para828{"ABAB"}, ans828{12}, }, diff --git a/leetcode/0832.Flipping-an-Image/832. Flipping an Image_test.go b/leetcode/0832.Flipping-an-Image/832. Flipping an Image_test.go index de639ef7..9705a0bb 100644 --- a/leetcode/0832.Flipping-an-Image/832. Flipping an Image_test.go +++ b/leetcode/0832.Flipping-an-Image/832. Flipping an Image_test.go @@ -26,19 +26,19 @@ func Test_Problem832(t *testing.T) { qs := []question832{ - question832{ - para832{[][]int{[]int{1, 1, 0}, []int{1, 0, 1}, []int{0, 0, 0}}}, - ans832{[][]int{[]int{1, 0, 0}, []int{0, 1, 0}, []int{1, 1, 1}}}, + { + para832{[][]int{{1, 1, 0}, {1, 0, 1}, {0, 0, 0}}}, + ans832{[][]int{{1, 0, 0}, {0, 1, 0}, {1, 1, 1}}}, }, - question832{ - para832{[][]int{[]int{1, 1, 0, 0}, []int{1, 0, 0, 1}, []int{0, 1, 1, 1}, []int{1, 0, 1, 0}}}, - ans832{[][]int{[]int{1, 1, 0, 0}, []int{0, 1, 1, 0}, []int{0, 0, 0, 1}, []int{1, 0, 1, 0}}}, + { + para832{[][]int{{1, 1, 0, 0}, {1, 0, 0, 1}, {0, 1, 1, 1}, {1, 0, 1, 0}}}, + ans832{[][]int{{1, 1, 0, 0}, {0, 1, 1, 0}, {0, 0, 0, 1}, {1, 0, 1, 0}}}, }, - question832{ - para832{[][]int{[]int{1, 1, 1}, []int{1, 1, 1}, []int{0, 0, 0}}}, - ans832{[][]int{[]int{0, 0, 0}, []int{0, 0, 0}, []int{1, 1, 1}}}, + { + para832{[][]int{{1, 1, 1}, {1, 1, 1}, {0, 0, 0}}}, + ans832{[][]int{{0, 0, 0}, {0, 0, 0}, {1, 1, 1}}}, }, } diff --git a/leetcode/0834.Sum-of-Distances-in-Tree/834. Sum of Distances in Tree_test.go b/leetcode/0834.Sum-of-Distances-in-Tree/834. Sum of Distances in Tree_test.go index 6e6f0961..7df04f42 100644 --- a/leetcode/0834.Sum-of-Distances-in-Tree/834. Sum of Distances in Tree_test.go +++ b/leetcode/0834.Sum-of-Distances-in-Tree/834. Sum of Distances in Tree_test.go @@ -27,13 +27,13 @@ func Test_Problem834(t *testing.T) { qs := []question834{ - question834{ - para834{4, [][]int{[]int{1, 2}, []int{3, 2}, []int{3, 0}}}, + { + para834{4, [][]int{{1, 2}, {3, 2}, {3, 0}}}, ans834{[]int{6, 6, 4, 4}}, }, - question834{ - para834{6, [][]int{[]int{0, 1}, []int{0, 2}, []int{2, 3}, []int{2, 4}, []int{2, 5}}}, + { + para834{6, [][]int{{0, 1}, {0, 2}, {2, 3}, {2, 4}, {2, 5}}}, ans834{[]int{8, 12, 6, 10, 10, 10}}, }, } diff --git a/leetcode/0836.Rectangle-Overlap/836. Rectangle Overlap_test.go b/leetcode/0836.Rectangle-Overlap/836. Rectangle Overlap_test.go index 82bd577b..2acbcb4d 100644 --- a/leetcode/0836.Rectangle-Overlap/836. Rectangle Overlap_test.go +++ b/leetcode/0836.Rectangle-Overlap/836. Rectangle Overlap_test.go @@ -27,12 +27,12 @@ func Test_Problem836(t *testing.T) { qs := []question836{ - question836{ + { para836{[]int{0, 0, 2, 2}, []int{1, 1, 3, 3}}, ans836{true}, }, - question836{ + { para836{[]int{0, 0, 1, 1}, []int{1, 0, 2, 1}}, ans836{false}, }, diff --git a/leetcode/0838.Push-Dominoes/838. Push Dominoes_test.go b/leetcode/0838.Push-Dominoes/838. Push Dominoes_test.go index 26b4ebd4..83aa148b 100644 --- a/leetcode/0838.Push-Dominoes/838. Push Dominoes_test.go +++ b/leetcode/0838.Push-Dominoes/838. Push Dominoes_test.go @@ -26,17 +26,17 @@ func Test_Problem838(t *testing.T) { qs := []question838{ - question838{ + { para838{".L.R...LR..L.."}, ans838{"LL.RR.LLRRLL.."}, }, - question838{ + { para838{"RR.L"}, ans838{"RR.L"}, }, - question838{ + { para838{".L.R."}, ans838{"LL.RR"}, }, diff --git a/leetcode/0839.Similar-String-Groups/839. Similar String Groups_test.go b/leetcode/0839.Similar-String-Groups/839. Similar String Groups_test.go index d469edc1..1482cc50 100644 --- a/leetcode/0839.Similar-String-Groups/839. Similar String Groups_test.go +++ b/leetcode/0839.Similar-String-Groups/839. Similar String Groups_test.go @@ -26,7 +26,7 @@ func Test_Problem839(t *testing.T) { qs := []question839{ - question839{ + { para839{[]string{"tars", "rats", "arts", "star"}}, ans839{2}, }, diff --git a/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms_test.go b/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms_test.go index ae64e7b3..8d3dfed9 100644 --- a/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms_test.go +++ b/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms_test.go @@ -26,13 +26,13 @@ func Test_Problem841(t *testing.T) { qs := []question841{ - question841{ - para841{[][]int{[]int{1}, []int{2}, []int{3}, []int{}}}, + { + para841{[][]int{{1}, {2}, {3}, {}}}, ans841{true}, }, - question841{ - para841{[][]int{[]int{1, 3}, []int{3, 0, 1}, []int{2}, []int{0}}}, + { + para841{[][]int{{1, 3}, {3, 0, 1}, {2}, {0}}}, ans841{false}, }, } diff --git a/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go b/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go index 88d21ed2..b6e20c4c 100644 --- a/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go +++ b/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go @@ -26,37 +26,37 @@ func Test_Problem842(t *testing.T) { qs := []question842{ - question842{ + { para842{"11235813"}, ans842{[]int{1, 1, 2, 3, 5, 8, 13}}, }, - question842{ + { para842{"123456579"}, ans842{[]int{123, 456, 579}}, }, - question842{ + { para842{"112358130"}, ans842{[]int{}}, }, - question842{ + { para842{"0123"}, ans842{[]int{}}, }, - question842{ + { para842{"1101111"}, ans842{[]int{110, 1, 111}}, }, - question842{ + { para842{"539834657215398346785398346991079669377161950407626991734534318677529701785098211336528511"}, ans842{[]int{}}, }, - question842{ + { para842{"3611537383985343591834441270352104793375145479938855071433500231900737525076071514982402115895535257195564161509167334647108949738176284385285234123461518508746752631120827113919550237703163294909"}, ans842{[]int{}}, }, diff --git a/leetcode/0844.Backspace-String-Compare/844. Backspace String Compare_test.go b/leetcode/0844.Backspace-String-Compare/844. Backspace String Compare_test.go index 5d7542f8..7047964e 100644 --- a/leetcode/0844.Backspace-String-Compare/844. Backspace String Compare_test.go +++ b/leetcode/0844.Backspace-String-Compare/844. Backspace String Compare_test.go @@ -27,22 +27,22 @@ func Test_Problem844(t *testing.T) { qs := []question844{ - question844{ + { para844{"ab#c", "ad#c"}, ans844{true}, }, - question844{ + { para844{"ab##", "c#d#"}, ans844{true}, }, - question844{ + { para844{"a##c", "#a#c"}, ans844{true}, }, - question844{ + { para844{"a#c", "b"}, ans844{false}, }, diff --git a/leetcode/0845.Longest-Mountain-in-Array/845. Longest Mountain in Array_test.go b/leetcode/0845.Longest-Mountain-in-Array/845. Longest Mountain in Array_test.go index ab87a6d3..9edaaa4e 100644 --- a/leetcode/0845.Longest-Mountain-in-Array/845. Longest Mountain in Array_test.go +++ b/leetcode/0845.Longest-Mountain-in-Array/845. Longest Mountain in Array_test.go @@ -25,27 +25,27 @@ type ans845 struct { func Test_Problem845(t *testing.T) { qs := []question845{ - question845{ + { para845{[]int{875, 884, 239, 731, 723, 685}}, ans845{4}, }, - question845{ + { para845{[]int{0, 1, 2, 3, 4, 5, 4, 3, 2, 1, 0}}, ans845{11}, }, - question845{ + { para845{[]int{2, 3}}, ans845{0}, }, - question845{ + { para845{[]int{2, 1, 4, 7, 3, 2, 5}}, ans845{5}, }, - question845{ + { para845{[]int{2, 2, 2}}, ans845{0}, }, diff --git a/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go b/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go index fa749815..69f9f940 100644 --- a/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go +++ b/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go @@ -26,23 +26,23 @@ func Test_Problem850(t *testing.T) { qs := []question850{ - question850{ - para850{[][]int{[]int{0, 0, 3, 3}, []int{2, 0, 5, 3}, []int{1, 1, 4, 4}}}, + { + para850{[][]int{{0, 0, 3, 3}, {2, 0, 5, 3}, {1, 1, 4, 4}}}, ans850{18}, }, - question850{ - para850{[][]int{[]int{0, 0, 1, 1}, []int{2, 2, 3, 3}}}, + { + para850{[][]int{{0, 0, 1, 1}, {2, 2, 3, 3}}}, ans850{2}, }, - question850{ - para850{[][]int{[]int{0, 0, 2, 2}, []int{1, 0, 2, 3}, []int{1, 0, 3, 1}}}, + { + para850{[][]int{{0, 0, 2, 2}, {1, 0, 2, 3}, {1, 0, 3, 1}}}, ans850{6}, }, - question850{ - para850{[][]int{[]int{0, 0, 1000000000, 1000000000}}}, + { + para850{[][]int{{0, 0, 1000000000, 1000000000}}}, ans850{49}, }, } diff --git a/leetcode/0851.Loud-and-Rich/851. Loud and Rich_test.go b/leetcode/0851.Loud-and-Rich/851. Loud and Rich_test.go index bd06e31b..f3ebd587 100644 --- a/leetcode/0851.Loud-and-Rich/851. Loud and Rich_test.go +++ b/leetcode/0851.Loud-and-Rich/851. Loud and Rich_test.go @@ -27,8 +27,8 @@ func Test_Problem851(t *testing.T) { qs := []question851{ - question851{ - para851{[][]int{[]int{1, 0}, []int{2, 1}, []int{3, 1}, []int{3, 7}, []int{4, 3}, []int{5, 3}}, []int{3, 2, 5, 4, 6, 1, 7, 0}}, + { + para851{[][]int{{1, 0}, {2, 1}, {3, 1}, {3, 7}, {4, 3}, {5, 3}}, []int{3, 2, 5, 4, 6, 1, 7, 0}}, ans851{[]int{5, 5, 2, 5, 4, 5, 6, 7}}, }, } diff --git a/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go b/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go index 28427fbd..431cd572 100644 --- a/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go +++ b/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go @@ -26,12 +26,12 @@ func Test_Problem852(t *testing.T) { qs := []question852{ - question852{ + { para852{[]int{0, 1, 0}}, ans852{1}, }, - question852{ + { para852{[]int{0, 2, 1, 0}}, ans852{1}, }, diff --git a/leetcode/0853.Car-Fleet/853. Car Fleet_test.go b/leetcode/0853.Car-Fleet/853. Car Fleet_test.go index bfeac040..03fc2d39 100644 --- a/leetcode/0853.Car-Fleet/853. Car Fleet_test.go +++ b/leetcode/0853.Car-Fleet/853. Car Fleet_test.go @@ -28,7 +28,7 @@ func Test_Problem853(t *testing.T) { qs := []question853{ - question853{ + { para853{12, []int{10, 8, 0, 5, 3}, []int{2, 4, 1, 1, 3}}, ans853{3}, }, diff --git a/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses_test.go b/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses_test.go index 634f6c7d..d26fddfe 100644 --- a/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses_test.go +++ b/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses_test.go @@ -25,32 +25,32 @@ type ans856 struct { func Test_Problem856(t *testing.T) { qs := []question856{ - question856{ + { para856{"()"}, ans856{1}, }, - question856{ + { para856{"(())"}, ans856{2}, }, - question856{ + { para856{"()()"}, ans856{2}, }, - question856{ + { para856{"(()(()))"}, ans856{6}, }, - question856{ + { para856{"()(())"}, ans856{3}, }, - question856{ + { para856{"((()()))"}, ans856{8}, }, diff --git a/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K_test.go b/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K_test.go index 1bb266ca..8f585559 100644 --- a/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K_test.go +++ b/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K_test.go @@ -26,17 +26,17 @@ type ans862 struct { func Test_Problem862(t *testing.T) { qs := []question862{ - question862{ + { para862{[]int{1}, 1}, ans862{1}, }, - question862{ + { para862{[]int{1, 2}, 4}, ans862{-1}, }, - question862{ + { para862{[]int{2, -1, 2}, 3}, ans862{3}, }, diff --git a/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go b/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go index 6b6fdda7..766751e0 100644 --- a/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go +++ b/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go @@ -30,7 +30,7 @@ func Test_Problem863(t *testing.T) { qs := []question863{ - question863{ + { para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, []int{5}, 2}, ans863{[]int{7, 4, 1}}, }, diff --git a/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go b/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go index 20b77c96..fc34e987 100644 --- a/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go +++ b/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go @@ -6,10 +6,10 @@ import ( ) var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } // 解法一 BFS，利用状态压缩来过滤筛选状态 diff --git a/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys_test.go b/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys_test.go index 5f26e4cb..d1263f37 100644 --- a/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys_test.go +++ b/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys_test.go @@ -26,42 +26,42 @@ func Test_Problem864(t *testing.T) { qs := []question864{ - question864{ + { para864{[]string{".##..##..B", "##...#...#", "..##..#...", ".#..#b...#", "#.##.a.###", ".#....#...", ".##..#.#..", ".....###@.", "..........", ".........A"}}, ans864{11}, }, - question864{ + { para864{[]string{"Dd#b@", ".fE.e", "##.B.", "#.cA.", "aF.#C"}}, ans864{14}, }, - question864{ + { para864{[]string{"@...a", ".###A", "b.BCc"}}, ans864{10}, }, - question864{ + { para864{[]string{"@Aa"}}, ans864{-1}, }, - question864{ + { para864{[]string{"b", "A", "a", "@", "B"}}, ans864{3}, }, - question864{ + { para864{[]string{"@.a.#", "#####", "b.A.B"}}, ans864{-1}, }, - question864{ + { para864{[]string{"@.a.#", "###.#", "b.A.B"}}, ans864{8}, }, - question864{ + { para864{[]string{"@..aA", "..B#.", "....b"}}, ans864{6}, }, diff --git a/leetcode/0867.Transpose-Matrix/867. Transpose Matrix_test.go b/leetcode/0867.Transpose-Matrix/867. Transpose Matrix_test.go index e204553f..508dbaac 100644 --- a/leetcode/0867.Transpose-Matrix/867. Transpose Matrix_test.go +++ b/leetcode/0867.Transpose-Matrix/867. Transpose Matrix_test.go @@ -26,14 +26,14 @@ func Test_Problem867(t *testing.T) { qs := []question867{ - question867{ - para867{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}, []int{7, 8, 9}}}, - ans867{[][]int{[]int{1, 4, 7}, []int{2, 5, 8}, []int{3, 6, 9}}}, + { + para867{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}}, + ans867{[][]int{{1, 4, 7}, {2, 5, 8}, {3, 6, 9}}}, }, - question867{ - para867{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}}}, - ans867{[][]int{[]int{1, 4}, []int{2, 5}, []int{3, 6}}}, + { + para867{[][]int{{1, 2, 3}, {4, 5, 6}}}, + ans867{[][]int{{1, 4}, {2, 5}, {3, 6}}}, }, } diff --git a/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go b/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go index 80ac8bd3..c5eea70b 100644 --- a/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go +++ b/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go @@ -29,7 +29,7 @@ func Test_Problem872(t *testing.T) { qs := []question872{ - question872{ + { para872{[]int{-10, -3, 0, 5, 9}, []int{-10, -3, 0, 5, 9}}, ans872{true}, }, diff --git a/leetcode/0875.Koko-Eating-Bananas/875. Koko Eating Bananas_test.go b/leetcode/0875.Koko-Eating-Bananas/875. Koko Eating Bananas_test.go index f87c0d69..a2a6eba6 100644 --- a/leetcode/0875.Koko-Eating-Bananas/875. Koko Eating Bananas_test.go +++ b/leetcode/0875.Koko-Eating-Bananas/875. Koko Eating Bananas_test.go @@ -27,17 +27,17 @@ func Test_Problem875(t *testing.T) { qs := []question875{ - question875{ + { para875{[]int{3, 6, 7, 11}, 8}, ans875{4}, }, - question875{ + { para875{[]int{30, 11, 23, 4, 20}, 5}, ans875{30}, }, - question875{ + { para875{[]int{30, 11, 23, 4, 20}, 6}, ans875{23}, }, diff --git a/leetcode/0876.Middle-of-the-Linked-List/876. Middle of the Linked List_test.go b/leetcode/0876.Middle-of-the-Linked-List/876. Middle of the Linked List_test.go index c3c8a96f..93a565dc 100644 --- a/leetcode/0876.Middle-of-the-Linked-List/876. Middle of the Linked List_test.go +++ b/leetcode/0876.Middle-of-the-Linked-List/876. Middle of the Linked List_test.go @@ -28,21 +28,21 @@ func Test_Problem876(t *testing.T) { qs := []question876{ - question876{ + { para876{[]int{1, 2, 3, 4, 5}}, ans876{3}, }, - question876{ + { para876{[]int{1, 2, 3, 4}}, ans876{3}, }, - question876{ + { para876{[]int{1}}, ans876{1}, }, - question876{ + { para876{[]int{}}, ans876{}, }, diff --git a/leetcode/0878.Nth-Magical-Number/878. Nth Magical Number_test.go b/leetcode/0878.Nth-Magical-Number/878. Nth Magical Number_test.go index c917196d..60cdcc0b 100644 --- a/leetcode/0878.Nth-Magical-Number/878. Nth Magical Number_test.go +++ b/leetcode/0878.Nth-Magical-Number/878. Nth Magical Number_test.go @@ -28,27 +28,27 @@ func Test_Problem878(t *testing.T) { qs := []question878{ - question878{ + { para878{1, 2, 3}, ans878{2}, }, - question878{ + { para878{4, 2, 3}, ans878{6}, }, - question878{ + { para878{5, 2, 4}, ans878{10}, }, - question878{ + { para878{3, 6, 4}, ans878{8}, }, - question878{ + { para878{1000000000, 40000, 40000}, ans878{999720007}, }, diff --git a/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go b/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go index 8eeaf89e..016576c9 100644 --- a/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go +++ b/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go @@ -27,32 +27,32 @@ func Test_Problem880(t *testing.T) { qs := []question880{ - question880{ + { para880{"aw4eguc6cs", 41}, ans880{"a"}, }, - question880{ + { para880{"vk6u5xhq9v", 554}, ans880{"h"}, }, - question880{ + { para880{"leet2code3", 10}, ans880{"o"}, }, - question880{ + { para880{"ha22", 5}, ans880{"h"}, }, - question880{ + { para880{"a2345678999999999999999", 1}, ans880{"a"}, }, - question880{ + { para880{"y959q969u3hb22odq595", 222280369}, ans880{"q"}, }, diff --git a/leetcode/0881.Boats-to-Save-People/881. Boats to Save People_test.go b/leetcode/0881.Boats-to-Save-People/881. Boats to Save People_test.go index 558eff83..5893f286 100644 --- a/leetcode/0881.Boats-to-Save-People/881. Boats to Save People_test.go +++ b/leetcode/0881.Boats-to-Save-People/881. Boats to Save People_test.go @@ -27,27 +27,27 @@ func Test_Problem881(t *testing.T) { qs := []question881{ - question881{ + { para881{[]int{1, 2}, 3}, ans881{1}, }, - question881{ + { para881{[]int{3, 2, 2, 1}, 3}, ans881{3}, }, - question881{ + { para881{[]int{3, 5, 3, 4}, 5}, ans881{4}, }, - question881{ + { para881{[]int{5, 1, 4, 2}, 6}, ans881{2}, }, - question881{ + { para881{[]int{3, 2, 2, 1}, 3}, ans881{3}, }, diff --git a/leetcode/0884.Uncommon-Words-from-Two-Sentences/884. Uncommon Words from Two Sentences_test.go b/leetcode/0884.Uncommon-Words-from-Two-Sentences/884. Uncommon Words from Two Sentences_test.go index ee461865..52d0da9c 100644 --- a/leetcode/0884.Uncommon-Words-from-Two-Sentences/884. Uncommon Words from Two Sentences_test.go +++ b/leetcode/0884.Uncommon-Words-from-Two-Sentences/884. Uncommon Words from Two Sentences_test.go @@ -27,12 +27,12 @@ func Test_Problem884(t *testing.T) { qs := []question884{ - question884{ + { para884{"this apple is sweet", "this apple is sour"}, ans884{[]string{"sweet", "sour"}}, }, - question884{ + { para884{"apple apple", "banana"}, ans884{[]string{"banana"}}, }, diff --git a/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III.go b/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III.go index 5e7d8bfd..5ed9e8fc 100644 --- a/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III.go +++ b/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III.go @@ -2,10 +2,10 @@ package leetcode func spiralMatrixIII(R int, C int, r0 int, c0 int) [][]int { res, round, spDir := [][]int{}, 0, [][]int{ - []int{0, 1}, // 朝右 - []int{1, 0}, // 朝下 - []int{0, -1}, // 朝左 - []int{-1, 0}, // 朝上 + {0, 1}, // 朝右 + {1, 0}, // 朝下 + {0, -1}, // 朝左 + {-1, 0}, // 朝上 } res = append(res, []int{r0, c0}) for i := 0; len(res) < R*C; i++ { diff --git a/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III_test.go b/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III_test.go index fa45c821..ea2c844a 100644 --- a/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III_test.go +++ b/leetcode/0885.Spiral-Matrix-III/885. Spiral Matrix III_test.go @@ -29,16 +29,16 @@ func Test_Problem885(t *testing.T) { qs := []question885{ - question885{ + { para885{1, 4, 0, 0}, - ans885{[][]int{[]int{0, 0}, []int{0, 1}, []int{0, 2}, []int{0, 3}}}, + ans885{[][]int{{0, 0}, {0, 1}, {0, 2}, {0, 3}}}, }, - question885{ + { para885{5, 6, 1, 4}, - ans885{[][]int{[]int{1, 4}, []int{1, 5}, []int{2, 5}, []int{2, 4}, []int{2, 3}, []int{1, 3}, []int{0, 3}, []int{0, 4}, []int{0, 5}, []int{3, 5}, []int{3, 4}, - []int{3, 3}, []int{3, 2}, []int{2, 2}, []int{1, 2}, []int{0, 2}, []int{4, 5}, []int{4, 4}, []int{4, 3}, []int{4, 2}, []int{4, 1}, []int{3, 1}, []int{2, 1}, - []int{1, 1}, []int{0, 1}, []int{4, 0}, []int{3, 0}, []int{2, 0}, []int{1, 0}, []int{0, 0}}}, + ans885{[][]int{{1, 4}, {1, 5}, {2, 5}, {2, 4}, {2, 3}, {1, 3}, {0, 3}, {0, 4}, {0, 5}, {3, 5}, {3, 4}, + {3, 3}, {3, 2}, {2, 2}, {1, 2}, {0, 2}, {4, 5}, {4, 4}, {4, 3}, {4, 2}, {4, 1}, {3, 1}, {2, 1}, + {1, 1}, {0, 1}, {4, 0}, {3, 0}, {2, 0}, {1, 0}, {0, 0}}}, }, } diff --git a/leetcode/0887.Super-Egg-Drop/887. Super Egg Drop_test.go b/leetcode/0887.Super-Egg-Drop/887. Super Egg Drop_test.go index d59ebad0..1fa604e5 100644 --- a/leetcode/0887.Super-Egg-Drop/887. Super Egg Drop_test.go +++ b/leetcode/0887.Super-Egg-Drop/887. Super Egg Drop_test.go @@ -27,17 +27,17 @@ func Test_Problem887(t *testing.T) { qs := []question887{ - question887{ + { para887{1, 2}, ans887{2}, }, - question887{ + { para887{2, 6}, ans887{3}, }, - question887{ + { para887{3, 14}, ans887{4}, }, diff --git a/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap_test.go b/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap_test.go index 227b2878..ef8760ec 100644 --- a/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap_test.go +++ b/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap_test.go @@ -27,27 +27,27 @@ func Test_Problem888(t *testing.T) { qs := []question888{ - question888{ + { para888{[]int{}, []int{}}, ans888{[]int{}}, }, - question888{ + { para888{[]int{1, 1}, []int{2, 2}}, ans888{[]int{1, 2}}, }, - question888{ + { para888{[]int{1, 2}, []int{2, 3}}, ans888{[]int{1, 2}}, }, - question888{ + { para888{[]int{2}, []int{1, 3}}, ans888{[]int{2, 3}}, }, - question888{ + { para888{[]int{1, 2, 5}, []int{2, 4}}, ans888{[]int{5, 4}}, }, diff --git a/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths_test.go b/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths_test.go index 6a0481dc..4fa59015 100644 --- a/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths_test.go +++ b/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths_test.go @@ -26,12 +26,12 @@ func Test_Problem891(t *testing.T) { qs := []question891{ - question891{ + { para891{[]int{2, 1, 3}}, ans891{6}, }, - question891{ + { para891{[]int{3, 7, 2, 3}}, ans891{35}, }, diff --git a/leetcode/0892.Surface-Area-of-3D-Shapes/892. Surface Area of 3D Shapes_test.go b/leetcode/0892.Surface-Area-of-3D-Shapes/892. Surface Area of 3D Shapes_test.go index e487bf96..79aa2d11 100644 --- a/leetcode/0892.Surface-Area-of-3D-Shapes/892. Surface Area of 3D Shapes_test.go +++ b/leetcode/0892.Surface-Area-of-3D-Shapes/892. Surface Area of 3D Shapes_test.go @@ -26,28 +26,28 @@ func Test_Problem892(t *testing.T) { qs := []question892{ - question892{ - para892{[][]int{[]int{2}}}, + { + para892{[][]int{{2}}}, ans892{10}, }, - question892{ - para892{[][]int{[]int{1, 2}, []int{3, 4}}}, + { + para892{[][]int{{1, 2}, {3, 4}}}, ans892{34}, }, - question892{ - para892{[][]int{[]int{1, 0}, []int{0, 2}}}, + { + para892{[][]int{{1, 0}, {0, 2}}}, ans892{16}, }, - question892{ - para892{[][]int{[]int{1, 1, 1}, []int{1, 0, 1}, []int{1, 1, 1}}}, + { + para892{[][]int{{1, 1, 1}, {1, 0, 1}, {1, 1, 1}}}, ans892{32}, }, - question892{ - para892{[][]int{[]int{2, 2, 2}, []int{2, 1, 2}, []int{2, 2, 2}}}, + { + para892{[][]int{{2, 2, 2}, {2, 1, 2}, {2, 2, 2}}}, ans892{46}, }, } diff --git a/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go b/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go index 38a54fa7..2b111205 100644 --- a/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go +++ b/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go @@ -26,32 +26,32 @@ func Test_Problem896(t *testing.T) { qs := []question896{ - question896{ + { para896{[]int{2, 1, 3}}, ans896{false}, }, - question896{ + { para896{[]int{1, 2, 2, 3}}, ans896{true}, }, - question896{ + { para896{[]int{6, 5, 4, 4}}, ans896{true}, }, - question896{ + { para896{[]int{1, 3, 2}}, ans896{false}, }, - question896{ + { para896{[]int{1, 2, 4, 5}}, ans896{true}, }, - question896{ + { para896{[]int{1, 1, 1}}, ans896{true}, }, diff --git a/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree.go b/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree.go index 68d2ad6a..2d4070e0 100644 --- a/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree.go +++ b/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree.go @@ -37,12 +37,12 @@ func recBST(root, tail *TreeNode) *TreeNode { // 解法二 模拟 func increasingBST1(root *TreeNode) *TreeNode { - list, newRoot := []int{}, &TreeNode{} + list := []int{} inorder(root, &list) if len(list) == 0 { return root } - newRoot = &TreeNode{Val: list[0], Left: nil, Right: nil} + newRoot := &TreeNode{Val: list[0], Left: nil, Right: nil} cur := newRoot for index := 1; index < len(list); index++ { tmp := &TreeNode{Val: list[index], Left: nil, Right: nil} diff --git a/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree_test.go b/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree_test.go index 53e4af2b..b92a97f1 100644 --- a/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree_test.go +++ b/leetcode/0897.Increasing-Order-Search-Tree/897. Increasing Order Search Tree_test.go @@ -28,42 +28,42 @@ func Test_Problem897(t *testing.T) { qs := []question897{ - question897{ + { para897{[]int{5, 3, 6, 2, 4, structures.NULL, 8, 1, structures.NULL, structures.NULL, structures.NULL, 7, 9}}, ans897{[]int{1, structures.NULL, 2, structures.NULL, 3, structures.NULL, 4, structures.NULL, 5, structures.NULL, 6, structures.NULL, 7, structures.NULL, 8, structures.NULL, 9}}, }, - question897{ + { para897{[]int{3, 4, 4, 5, structures.NULL, structures.NULL, 5, 6, structures.NULL, structures.NULL, 6}}, ans897{[]int{6, structures.NULL, 5, structures.NULL, 4, structures.NULL, 3, structures.NULL, 4, structures.NULL, 5, structures.NULL, 6}}, }, - question897{ + { para897{[]int{1, 2, 2, structures.NULL, 3, 3}}, ans897{[]int{2, structures.NULL, 3, structures.NULL, 1, structures.NULL, 3, structures.NULL, 2}}, }, - question897{ + { para897{[]int{}}, ans897{[]int{}}, }, - question897{ + { para897{[]int{1}}, ans897{[]int{1}}, }, - question897{ + { para897{[]int{1, 2, 3}}, ans897{[]int{2, structures.NULL, 1, structures.NULL, 3}}, }, - question897{ + { para897{[]int{1, 2, 2, 3, 4, 4, 3}}, ans897{[]int{3, structures.NULL, 2, structures.NULL, 4, structures.NULL, 1, structures.NULL, 4, structures.NULL, 2, structures.NULL, 3}}, }, - question897{ + { para897{[]int{1, 2, 2, structures.NULL, 3, structures.NULL, 3}}, ans897{[]int{2, structures.NULL, 3, structures.NULL, 1, structures.NULL, 2, structures.NULL, 3}}, }, diff --git a/leetcode/0898.Bitwise-ORs-of-Subarrays/898. Bitwise ORs of Subarrays_test.go b/leetcode/0898.Bitwise-ORs-of-Subarrays/898. Bitwise ORs of Subarrays_test.go index 5387263b..7c81c146 100644 --- a/leetcode/0898.Bitwise-ORs-of-Subarrays/898. Bitwise ORs of Subarrays_test.go +++ b/leetcode/0898.Bitwise-ORs-of-Subarrays/898. Bitwise ORs of Subarrays_test.go @@ -26,17 +26,17 @@ func Test_Problem898(t *testing.T) { qs := []question898{ - question898{ + { para898{[]int{0}}, ans898{1}, }, - question898{ + { para898{[]int{1, 1, 2}}, ans898{3}, }, - question898{ + { para898{[]int{1, 2, 4}}, ans898{6}, }, diff --git a/leetcode/0904.Fruit-Into-Baskets/904. Fruit Into Baskets_test.go b/leetcode/0904.Fruit-Into-Baskets/904. Fruit Into Baskets_test.go index c8201408..ade6eb94 100644 --- a/leetcode/0904.Fruit-Into-Baskets/904. Fruit Into Baskets_test.go +++ b/leetcode/0904.Fruit-Into-Baskets/904. Fruit Into Baskets_test.go @@ -26,41 +26,41 @@ func Test_Problem904(t *testing.T) { qs := []question904{ - question904{ + { para904{[]int{1, 1}}, ans904{2}, }, - question904{ + { para904{[]int{1, 2, 1}}, ans904{3}, }, - question904{ + { para904{[]int{0, 1, 2, 2}}, ans904{3}, }, - question904{ + { para904{[]int{1, 2, 3, 2, 2}}, ans904{4}, }, - question904{ + { para904{[]int{3, 3, 3, 1, 2, 1, 1, 2, 3, 3, 4}}, ans904{5}, }, - question904{ + { para904{[]int{4, 5}}, ans904{2}, }, - question904{ + { para904{[]int{1}}, ans904{1}, }, - question904{ + { para904{[]int{}}, ans904{}, }, diff --git a/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums_test.go b/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums_test.go index 01b2eb58..b21f74fd 100644 --- a/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums_test.go +++ b/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums_test.go @@ -26,7 +26,7 @@ func Test_Problem907(t *testing.T) { qs := []question907{ - question907{ + { para907{[]int{3, 1, 2, 4}}, ans907{17}, }, diff --git a/leetcode/0914.X-of-a-Kind-in-a-Deck-of-Cards/914. X of a Kind in a Deck of Cards_test.go b/leetcode/0914.X-of-a-Kind-in-a-Deck-of-Cards/914. X of a Kind in a Deck of Cards_test.go index 598daee8..3372ee55 100644 --- a/leetcode/0914.X-of-a-Kind-in-a-Deck-of-Cards/914. X of a Kind in a Deck of Cards_test.go +++ b/leetcode/0914.X-of-a-Kind-in-a-Deck-of-Cards/914. X of a Kind in a Deck of Cards_test.go @@ -26,27 +26,27 @@ func Test_Problem914(t *testing.T) { qs := []question914{ - question914{ + { para914{[]int{1, 2, 3, 4, 4, 3, 2, 1}}, ans914{true}, }, - question914{ + { para914{[]int{1, 1, 1, 2, 2, 2, 3, 3}}, ans914{false}, }, - question914{ + { para914{[]int{1}}, ans914{false}, }, - question914{ + { para914{[]int{1, 1}}, ans914{true}, }, - question914{ + { para914{[]int{1, 1, 2, 2, 2, 2}}, ans914{true}, }, diff --git a/leetcode/0918.Maximum-Sum-Circular-Subarray/918. Maximum Sum Circular Subarray_test.go b/leetcode/0918.Maximum-Sum-Circular-Subarray/918. Maximum Sum Circular Subarray_test.go index b601a8ed..f7d25c08 100644 --- a/leetcode/0918.Maximum-Sum-Circular-Subarray/918. Maximum Sum Circular Subarray_test.go +++ b/leetcode/0918.Maximum-Sum-Circular-Subarray/918. Maximum Sum Circular Subarray_test.go @@ -26,27 +26,27 @@ func Test_Problem918(t *testing.T) { qs := []question918{ - question918{ + { para918{[]int{1, -2, 3, -2}}, ans918{3}, }, - question918{ + { para918{[]int{5, -3, 5}}, ans918{10}, }, - question918{ + { para918{[]int{3, -1, 2, -1}}, ans918{4}, }, - question918{ + { para918{[]int{3, -2, 2, -3}}, ans918{3}, }, - question918{ + { para918{[]int{-2, -3, -1}}, ans918{-1}, }, diff --git a/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists_test.go b/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists_test.go index e51c67d2..39ed3511 100644 --- a/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists_test.go +++ b/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists_test.go @@ -28,17 +28,17 @@ func Test_Problem920(t *testing.T) { qs := []question920{ - question920{ + { para920{3, 3, 1}, ans920{6}, }, - question920{ + { para920{2, 3, 0}, ans920{6}, }, - question920{ + { para920{2, 3, 1}, ans920{2}, }, diff --git a/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go b/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go index c1be5eee..24e5c55b 100644 --- a/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go +++ b/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go @@ -25,22 +25,22 @@ type ans921 struct { func Test_Problem921(t *testing.T) { qs := []question921{ - question921{ + { para921{"())"}, ans921{1}, }, - question921{ + { para921{"((("}, ans921{3}, }, - question921{ + { para921{"()"}, ans921{0}, }, - question921{ + { para921{"()))(("}, ans921{4}, }, diff --git a/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II_test.go b/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II_test.go index 92a4277e..235e0602 100644 --- a/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II_test.go +++ b/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II_test.go @@ -26,17 +26,17 @@ func Test_Problem922(t *testing.T) { qs := []question922{ - question922{ + { para922{[]int{}}, ans922{[]int{}}, }, - question922{ + { para922{[]int{1}}, ans922{[]int{}}, }, - question922{ + { para922{[]int{4, 2, 5, 7}}, ans922{[]int{4, 5, 2, 7}}, }, diff --git a/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go b/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go index d01c4218..50550956 100644 --- a/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go +++ b/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go @@ -27,12 +27,12 @@ func Test_Problem923(t *testing.T) { qs := []question923{ - question923{ + { para923{[]int{1, 1, 2, 2, 3, 3, 4, 4, 5, 5}, 8}, ans923{20}, }, - question923{ + { para923{[]int{1, 1, 2, 2, 2, 2}, 5}, ans923{12}, }, diff --git a/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go b/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go index 6973f0d8..8c9576e6 100644 --- a/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go +++ b/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go @@ -27,28 +27,28 @@ func Test_Problem924(t *testing.T) { qs := []question924{ - question924{ - para924{[][]int{[]int{1, 0, 0, 0}, []int{0, 1, 0, 0}, []int{0, 0, 1, 1}, []int{0, 0, 1, 1}}, []int{3, 1}}, + { + para924{[][]int{{1, 0, 0, 0}, {0, 1, 0, 0}, {0, 0, 1, 1}, {0, 0, 1, 1}}, []int{3, 1}}, ans924{3}, }, - question924{ - para924{[][]int{[]int{1, 0, 0, 0, 0, 0}, []int{0, 1, 0, 0, 0, 0}, []int{0, 0, 1, 0, 0, 0}, []int{0, 0, 0, 1, 1, 0}, []int{0, 0, 0, 1, 1, 0}, []int{0, 0, 0, 0, 0, 1}}, []int{5, 0}}, + { + para924{[][]int{{1, 0, 0, 0, 0, 0}, {0, 1, 0, 0, 0, 0}, {0, 0, 1, 0, 0, 0}, {0, 0, 0, 1, 1, 0}, {0, 0, 0, 1, 1, 0}, {0, 0, 0, 0, 0, 1}}, []int{5, 0}}, ans924{0}, }, - question924{ - para924{[][]int{[]int{1, 1, 1}, []int{1, 1, 1}, []int{1, 1, 1}}, []int{1, 2}}, + { + para924{[][]int{{1, 1, 1}, {1, 1, 1}, {1, 1, 1}}, []int{1, 2}}, ans924{1}, }, - question924{ - para924{[][]int{[]int{1, 1, 0}, []int{1, 1, 0}, []int{0, 0, 1}}, []int{0, 1}}, + { + para924{[][]int{{1, 1, 0}, {1, 1, 0}, {0, 0, 1}}, []int{0, 1}}, ans924{0}, }, - question924{ - para924{[][]int{[]int{1, 0, 0}, []int{0, 1, 0}, []int{0, 0, 1}}, []int{0, 2}}, + { + para924{[][]int{{1, 0, 0}, {0, 1, 0}, {0, 0, 1}}, []int{0, 2}}, ans924{0}, }, } diff --git a/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go b/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go index 31c7ce67..f374c797 100644 --- a/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go +++ b/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go @@ -27,27 +27,27 @@ func Test_Problem925(t *testing.T) { qs := []question925{ - question925{ + { para925{"alex", "aaleex"}, ans925{true}, }, - question925{ + { para925{"saeed", "ssaaedd"}, ans925{false}, }, - question925{ + { para925{"leelee", "lleeelee"}, ans925{true}, }, - question925{ + { para925{"laiden", "laiden"}, ans925{true}, }, - question925{ + { para925{"kikcxmvzi", "kiikcxxmmvvzz"}, ans925{false}, }, diff --git a/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go b/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go index f6d23034..5b376459 100644 --- a/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go +++ b/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go @@ -26,12 +26,12 @@ func Test_Problem927(t *testing.T) { qs := []question927{ - question927{ + { para927{[]int{1, 0, 1, 0, 1}}, ans927{[]int{0, 3}}, }, - question927{ + { para927{[]int{1, 1, 0, 1, 1}}, ans927{[]int{-1, -1}}, }, diff --git a/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go b/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go index 7d8552c2..b05bb162 100644 --- a/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go +++ b/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go @@ -27,37 +27,37 @@ func Test_Problem928(t *testing.T) { qs := []question928{ - question928{ - para928{[][]int{[]int{1, 0, 0, 0}, []int{0, 1, 1, 1}, []int{0, 1, 1, 0}, []int{0, 1, 0, 1}}, []int{1, 3}}, + { + para928{[][]int{{1, 0, 0, 0}, {0, 1, 1, 1}, {0, 1, 1, 0}, {0, 1, 0, 1}}, []int{1, 3}}, ans928{1}, }, - question928{ - para928{[][]int{[]int{1, 1, 1, 0}, []int{1, 1, 0, 0}, []int{1, 0, 1, 0}, []int{0, 0, 0, 1}}, []int{3, 2}}, + { + para928{[][]int{{1, 1, 1, 0}, {1, 1, 0, 0}, {1, 0, 1, 0}, {0, 0, 0, 1}}, []int{3, 2}}, ans928{2}, }, - question928{ - para928{[][]int{[]int{1, 1, 0}, []int{1, 1, 1}, []int{0, 1, 1}}, []int{0, 1}}, + { + para928{[][]int{{1, 1, 0}, {1, 1, 1}, {0, 1, 1}}, []int{0, 1}}, ans928{1}, }, - question928{ - para928{[][]int{[]int{1, 1, 0}, []int{1, 1, 0}, []int{0, 0, 1}}, []int{0, 1}}, + { + para928{[][]int{{1, 1, 0}, {1, 1, 0}, {0, 0, 1}}, []int{0, 1}}, ans928{0}, }, - question928{ - para928{[][]int{[]int{1, 1, 0, 0}, []int{1, 1, 1, 0}, []int{0, 1, 1, 1}, []int{0, 0, 1, 1}}, []int{0, 1}}, + { + para928{[][]int{{1, 1, 0, 0}, {1, 1, 1, 0}, {0, 1, 1, 1}, {0, 0, 1, 1}}, []int{0, 1}}, ans928{1}, }, - question928{ - para928{[][]int{[]int{1, 0, 0, 0}, []int{0, 1, 0, 0}, []int{0, 0, 1, 1}, []int{0, 0, 1, 1}}, []int{3, 1}}, + { + para928{[][]int{{1, 0, 0, 0}, {0, 1, 0, 0}, {0, 0, 1, 1}, {0, 0, 1, 1}}, []int{3, 1}}, ans928{3}, }, - question928{ - para928{[][]int{[]int{1, 0, 0, 0, 0, 0}, []int{0, 1, 0, 0, 0, 0}, []int{0, 0, 1, 0, 0, 0}, []int{0, 0, 0, 1, 1, 0}, []int{0, 0, 0, 1, 1, 0}, []int{0, 0, 0, 0, 0, 1}}, []int{5, 0}}, + { + para928{[][]int{{1, 0, 0, 0, 0, 0}, {0, 1, 0, 0, 0, 0}, {0, 0, 1, 0, 0, 0}, {0, 0, 0, 1, 1, 0}, {0, 0, 0, 1, 1, 0}, {0, 0, 0, 0, 0, 1}}, []int{5, 0}}, ans928{0}, }, } diff --git a/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum_test.go b/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum_test.go index 788653ad..e51d634a 100644 --- a/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum_test.go +++ b/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum_test.go @@ -27,17 +27,17 @@ func Test_Problem930(t *testing.T) { qs := []question930{ - question930{ + { para930{[]int{1, 0, 1, 0, 1}, 2}, ans930{4}, }, - question930{ + { para930{[]int{0, 0, 0, 0, 0}, 0}, ans930{15}, }, - question930{ + { para930{[]int{1, 0, 1, 1, 1, 1, 0, 1, 0, 1}, 2}, ans930{4}, }, diff --git a/leetcode/0942.DI-String-Match/942. DI String Match_test.go b/leetcode/0942.DI-String-Match/942. DI String Match_test.go index c0767e32..4b34dd95 100644 --- a/leetcode/0942.DI-String-Match/942. DI String Match_test.go +++ b/leetcode/0942.DI-String-Match/942. DI String Match_test.go @@ -26,17 +26,17 @@ func Test_Problem942(t *testing.T) { qs := []question942{ - question942{ + { para942{"IDID"}, ans942{[]int{0, 4, 1, 3, 2}}, }, - question942{ + { para942{"III"}, ans942{[]int{0, 1, 2, 3}}, }, - question942{ + { para942{"DDI"}, ans942{[]int{3, 2, 0, 1}}, }, diff --git a/leetcode/0946.Validate-Stack-Sequences/946. Validate Stack Sequences_test.go b/leetcode/0946.Validate-Stack-Sequences/946. Validate Stack Sequences_test.go index 3605c43c..51c8842f 100644 --- a/leetcode/0946.Validate-Stack-Sequences/946. Validate Stack Sequences_test.go +++ b/leetcode/0946.Validate-Stack-Sequences/946. Validate Stack Sequences_test.go @@ -26,17 +26,17 @@ type ans946 struct { func Test_Problem946(t *testing.T) { qs := []question946{ - question946{ + { para946{[]int{1, 2, 3, 4, 5}, []int{5, 4, 3, 2, 1}}, ans946{true}, }, - question946{ + { para946{[]int{1, 2, 3, 4, 5}, []int{4, 3, 5, 1, 2}}, ans946{false}, }, - question946{ + { para946{[]int{1, 0}, []int{1, 0}}, ans946{true}, }, diff --git a/leetcode/0947.Most-Stones-Removed-with-Same-Row-or-Column/947. Most Stones Removed with Same Row or Column_test.go b/leetcode/0947.Most-Stones-Removed-with-Same-Row-or-Column/947. Most Stones Removed with Same Row or Column_test.go index 54328dce..c77f1abe 100644 --- a/leetcode/0947.Most-Stones-Removed-with-Same-Row-or-Column/947. Most Stones Removed with Same Row or Column_test.go +++ b/leetcode/0947.Most-Stones-Removed-with-Same-Row-or-Column/947. Most Stones Removed with Same Row or Column_test.go @@ -25,18 +25,18 @@ type ans947 struct { func Test_Problem947(t *testing.T) { qs := []question947{ - question947{ - para947{[][]int{[]int{0, 0}, []int{0, 1}, []int{1, 0}, []int{1, 2}, []int{2, 1}, []int{2, 2}}}, + { + para947{[][]int{{0, 0}, {0, 1}, {1, 0}, {1, 2}, {2, 1}, {2, 2}}}, ans947{5}, }, - question947{ - para947{[][]int{[]int{0, 0}, []int{0, 2}, []int{1, 1}, []int{2, 0}, []int{2, 2}}}, + { + para947{[][]int{{0, 0}, {0, 2}, {1, 1}, {2, 0}, {2, 2}}}, ans947{3}, }, - question947{ - para947{[][]int{[]int{0, 0}}}, + { + para947{[][]int{{0, 0}}}, ans947{0}, }, } diff --git a/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits_test.go b/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits_test.go index 782f779b..29bbfa04 100644 --- a/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits_test.go +++ b/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits_test.go @@ -25,12 +25,12 @@ type ans949 struct { func Test_Problem949(t *testing.T) { qs := []question949{ - question949{ + { para949{[]int{1, 2, 3, 4}}, ans949{"23:41"}, }, - question949{ + { para949{[]int{5, 5, 5, 5}}, ans949{""}, }, diff --git a/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go b/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go index 7c05beb7..b2394286 100644 --- a/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go +++ b/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go @@ -25,22 +25,22 @@ type ans952 struct { func Test_Problem952(t *testing.T) { qs := []question952{ - question952{ + { para952{[]int{1, 2, 3, 4, 5, 6, 7, 8, 9}}, ans952{6}, }, - question952{ + { para952{[]int{4, 6, 15, 35}}, ans952{4}, }, - question952{ + { para952{[]int{20, 50, 9, 63}}, ans952{2}, }, - question952{ + { para952{[]int{2, 3, 6, 7, 4, 12, 21, 39}}, ans952{8}, }, diff --git a/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go b/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go index a20b82b6..6bb2be8a 100644 --- a/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go +++ b/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go @@ -26,17 +26,17 @@ type ans953 struct { func Test_Problem953(t *testing.T) { qs := []question953{ - question953{ + { para953{[]string{"hello", "leetcode"}, "hlabcdefgijkmnopqrstuvwxyz"}, ans953{true}, }, - question953{ + { para953{[]string{"word", "world", "row"}, "worldabcefghijkmnpqstuvxyz"}, ans953{false}, }, - question953{ + { para953{[]string{"apple", "app"}, "abcdefghijklmnopqrstuvwxyz"}, ans953{false}, }, diff --git a/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes_test.go b/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes_test.go index ec978a55..51a088ed 100644 --- a/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes_test.go +++ b/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes_test.go @@ -25,27 +25,27 @@ type ans959 struct { func Test_Problem959(t *testing.T) { qs := []question959{ - question959{ + { para959{[]string{" /", "/ "}}, ans959{2}, }, - question959{ + { para959{[]string{" /", " "}}, ans959{1}, }, - question959{ + { para959{[]string{"\\/", "/\\"}}, ans959{4}, }, - question959{ + { para959{[]string{"/\\", "\\/"}}, ans959{5}, }, - question959{ + { para959{[]string{"//", "/ "}}, ans959{3}, }, diff --git a/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go b/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go index f101197a..cadc95a7 100644 --- a/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go +++ b/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go @@ -25,17 +25,17 @@ type ans961 struct { func Test_Problem961(t *testing.T) { qs := []question961{ - question961{ + { para961{[]int{1, 2, 3, 3}}, ans961{3}, }, - question961{ + { para961{[]int{2, 1, 2, 5, 3, 2}}, ans961{2}, }, - question961{ + { para961{[]int{5, 1, 5, 2, 5, 3, 5, 4}}, ans961{5}, }, diff --git a/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go b/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go index 5f8971bd..9ab69d56 100644 --- a/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go +++ b/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go @@ -28,12 +28,12 @@ func Test_Problem968(t *testing.T) { qs := []question968{ - question968{ + { para968{[]int{0, 0, structures.NULL, 0, 0}}, ans968{1}, }, - question968{ + { para968{[]int{0, 0, structures.NULL, 0, structures.NULL, 0, structures.NULL, structures.NULL, 0}}, ans968{2}, }, diff --git a/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go b/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go index b44b3722..d2225393 100644 --- a/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go +++ b/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go @@ -26,17 +26,17 @@ func Test_Problem969(t *testing.T) { qs := []question969{ - question969{ + { para969{[]int{}}, ans969{[]int{}}, }, - question969{ + { para969{[]int{1}}, ans969{[]int{1}}, }, - question969{ + { para969{[]int{3, 2, 4, 1}}, ans969{[]int{3, 4, 2, 3, 1, 2}}, }, diff --git a/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go b/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go index 82eb8fdd..6501a364 100644 --- a/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go +++ b/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go @@ -28,12 +28,12 @@ func Test_Problem970(t *testing.T) { qs := []question970{ - question970{ + { para970{2, 3, 10}, ans970{[]int{2, 3, 4, 5, 7, 9, 10}}, }, - question970{ + { para970{3, 5, 15}, ans970{[]int{2, 4, 6, 8, 10, 14}}, }, diff --git a/leetcode/0973.K-Closest-Points-to-Origin/973. K Closest Points to Origin_test.go b/leetcode/0973.K-Closest-Points-to-Origin/973. K Closest Points to Origin_test.go index a5cc9d62..6ea66d66 100644 --- a/leetcode/0973.K-Closest-Points-to-Origin/973. K Closest Points to Origin_test.go +++ b/leetcode/0973.K-Closest-Points-to-Origin/973. K Closest Points to Origin_test.go @@ -27,24 +27,24 @@ func Test_Problem973(t *testing.T) { qs := []question973{ - question973{ - para973{[][]int{[]int{1, 3}, []int{-2, 2}}, 1}, - ans973{[][]int{[]int{-2, 2}}}, + { + para973{[][]int{{1, 3}, {-2, 2}}, 1}, + ans973{[][]int{{-2, 2}}}, }, - question973{ - para973{[][]int{[]int{1, 3}, []int{-2, 2}}, 0}, - ans973{[][]int{[]int{}}}, + { + para973{[][]int{{1, 3}, {-2, 2}}, 0}, + ans973{[][]int{{}}}, }, - question973{ - para973{[][]int{[]int{3, 3}, []int{5, -1}, []int{-2, 4}}, 2}, - ans973{[][]int{[]int{3, 3}, []int{-2, 4}}}, + { + para973{[][]int{{3, 3}, {5, -1}, {-2, 4}}, 2}, + ans973{[][]int{{3, 3}, {-2, 4}}}, }, - question973{ - para973{[][]int{[]int{0, 1}, []int{1, 0}}, 2}, - ans973{[][]int{[]int{1, 0}, []int{0, 1}}}, + { + para973{[][]int{{0, 1}, {1, 0}}, 2}, + ans973{[][]int{{1, 0}, {0, 1}}}, }, } diff --git a/leetcode/0976.Largest-Perimeter-Triangle/976. Largest Perimeter Triangle_test.go b/leetcode/0976.Largest-Perimeter-Triangle/976. Largest Perimeter Triangle_test.go index e16e9a5e..e044f42b 100644 --- a/leetcode/0976.Largest-Perimeter-Triangle/976. Largest Perimeter Triangle_test.go +++ b/leetcode/0976.Largest-Perimeter-Triangle/976. Largest Perimeter Triangle_test.go @@ -26,36 +26,36 @@ func Test_Problem976(t *testing.T) { qs := []question976{ - question976{ + { para976{[]int{1, 2}}, ans976{0}, }, - question976{ + { para976{[]int{1, 2, 3}}, ans976{0}, }, - question976{ + { para976{[]int{}}, ans976{0}, }, - question976{ + { para976{[]int{2, 1, 2}}, ans976{5}, }, - question976{ + { para976{[]int{1, 1, 2}}, ans976{0}, }, - question976{ + { para976{[]int{3, 2, 3, 4}}, ans976{10}, }, - question976{ + { para976{[]int{3, 6, 2, 3}}, ans976{8}, }, diff --git a/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array_test.go b/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array_test.go index 33e49b1d..01b7c9c9 100644 --- a/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array_test.go +++ b/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array_test.go @@ -26,17 +26,17 @@ func Test_Problem977(t *testing.T) { qs := []question977{ - question977{ + { para977{[]int{-4, -1, 0, 3, 10}}, ans977{[]int{0, 1, 9, 16, 100}}, }, - question977{ + { para977{[]int{1}}, ans977{[]int{1}}, }, - question977{ + { para977{[]int{-7, -3, 2, 3, 11}}, ans977{[]int{4, 9, 9, 49, 121}}, }, diff --git a/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go b/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go index cd3c1e80..cd16e06b 100644 --- a/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go +++ b/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go @@ -26,27 +26,27 @@ func Test_Problem978(t *testing.T) { qs := []question978{ - question978{ + { para978{[]int{0, 1, 1, 0, 1, 0, 1, 1, 0, 0}}, ans978{5}, }, - question978{ + { para978{[]int{9, 9}}, ans978{1}, }, - question978{ + { para978{[]int{9, 4, 2, 10, 7, 8, 8, 1, 9}}, ans978{5}, }, - question978{ + { para978{[]int{4, 8, 12, 16}}, ans978{2}, }, - question978{ + { para978{[]int{100}}, ans978{1}, }, diff --git a/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree_test.go b/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree_test.go index 201c8500..e38652ae 100644 --- a/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree_test.go +++ b/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree_test.go @@ -28,27 +28,27 @@ func Test_Problem979(t *testing.T) { qs := []question979{ - question979{ + { para979{[]int{}}, ans979{0}, }, - question979{ + { para979{[]int{1}}, ans979{0}, }, - question979{ + { para979{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans979{41}, }, - question979{ + { para979{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, 5}}, ans979{11}, }, - question979{ + { para979{[]int{1, 2, 3, 4, structures.NULL, 5}}, ans979{11}, }, diff --git a/leetcode/0980.Unique-Paths-III/980. Unique Paths III.go b/leetcode/0980.Unique-Paths-III/980. Unique Paths III.go index f2f4809a..9a145eee 100644 --- a/leetcode/0980.Unique-Paths-III/980. Unique Paths III.go +++ b/leetcode/0980.Unique-Paths-III/980. Unique Paths III.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func uniquePathsIII(grid [][]int) int { @@ -53,7 +53,7 @@ func findUniquePathIII(board [][]int, visited [][]bool, path []int, empty, start } } visited[startx][starty] = false - empty++ + //empty++ 这里虽然可以还原这个变量值，但是赋值没有意义，干脆不写了 path = path[:len(path)-2] } return diff --git a/leetcode/0980.Unique-Paths-III/980. Unique Paths III_test.go b/leetcode/0980.Unique-Paths-III/980. Unique Paths III_test.go index 1cdc6f88..571a2abc 100644 --- a/leetcode/0980.Unique-Paths-III/980. Unique Paths III_test.go +++ b/leetcode/0980.Unique-Paths-III/980. Unique Paths III_test.go @@ -26,28 +26,28 @@ func Test_Problem980(t *testing.T) { qs := []question980{ - question980{ + { para980{[][]int{ - []int{1, 0, 0, 0}, - []int{0, 0, 0, 0}, - []int{0, 0, 2, -1}, + {1, 0, 0, 0}, + {0, 0, 0, 0}, + {0, 0, 2, -1}, }}, ans980{2}, }, - question980{ + { para980{[][]int{ - []int{1, 0, 0, 0}, - []int{0, 0, 0, 0}, - []int{0, 0, 0, 2}, + {1, 0, 0, 0}, + {0, 0, 0, 0}, + {0, 0, 0, 2}, }}, ans980{4}, }, - question980{ + { para980{[][]int{ - []int{1, 0}, - []int{0, 2}, + {1, 0}, + {0, 2}, }}, ans980{0}, }, diff --git a/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go b/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go index 2c6c78bd..343ac3c7 100644 --- a/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go +++ b/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go @@ -27,12 +27,12 @@ func Test_Problem984(t *testing.T) { qs := []question984{ - question984{ + { para984{1, 2}, ans984{"abb"}, }, - question984{ + { para984{4, 1}, ans984{"aabaa"}, }, diff --git a/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries_test.go b/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries_test.go index ae1ad153..26d2b71f 100644 --- a/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries_test.go +++ b/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries_test.go @@ -27,8 +27,8 @@ func Test_Problem985(t *testing.T) { qs := []question985{ - question985{ - para985{[]int{1, 2, 3, 4}, [][]int{[]int{1, 0}, []int{-3, 1}, []int{-4, 0}, []int{2, 3}}}, + { + para985{[]int{1, 2, 3, 4}, [][]int{{1, 0}, {-3, 1}, {-4, 0}, {2, 3}}}, ans985{[]int{8, 6, 2, 4}}, }, } diff --git a/leetcode/0986.Interval-List-Intersections/986. Interval List Intersections_test.go b/leetcode/0986.Interval-List-Intersections/986. Interval List Intersections_test.go index a39c4a9e..8db5161c 100644 --- a/leetcode/0986.Interval-List-Intersections/986. Interval List Intersections_test.go +++ b/leetcode/0986.Interval-List-Intersections/986. Interval List Intersections_test.go @@ -27,11 +27,11 @@ func Test_Problem986(t *testing.T) { qs := []question986{ - question986{ - para986{[]Interval{Interval{Start: 0, End: 2}, Interval{Start: 5, End: 10}, Interval{Start: 13, End: 23}, Interval{Start: 24, End: 25}}, - []Interval{Interval{Start: 1, End: 5}, Interval{Start: 8, End: 12}, Interval{Start: 15, End: 24}, Interval{Start: 25, End: 26}}}, - ans986{[]Interval{Interval{Start: 1, End: 2}, Interval{Start: 5, End: 5}, Interval{Start: 8, End: 10}, - Interval{Start: 15, End: 23}, Interval{Start: 24, End: 24}, Interval{Start: 25, End: 25}}}, + { + para986{[]Interval{{Start: 0, End: 2}, {Start: 5, End: 10}, {Start: 13, End: 23}, {Start: 24, End: 25}}, + []Interval{{Start: 1, End: 5}, {Start: 8, End: 12}, {Start: 15, End: 24}, {Start: 25, End: 26}}}, + ans986{[]Interval{{Start: 1, End: 2}, {Start: 5, End: 5}, {Start: 8, End: 10}, + {Start: 15, End: 23}, {Start: 24, End: 24}, {Start: 25, End: 25}}}, }, } diff --git a/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go b/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go index 75b10c33..77c468db 100644 --- a/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go +++ b/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go @@ -26,27 +26,27 @@ func Test_Problem990(t *testing.T) { qs := []question990{ - question990{ + { para990{[]string{"a==b", "b!=a"}}, ans990{false}, }, - question990{ + { para990{[]string{"b==a", "a==b"}}, ans990{true}, }, - question990{ + { para990{[]string{"a==b", "b==c", "a==c"}}, ans990{true}, }, - question990{ + { para990{[]string{"a==b", "b!=c", "c==a"}}, ans990{false}, }, - question990{ + { para990{[]string{"c==c", "b==d", "x!=z"}}, ans990{true}, }, diff --git a/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers_test.go b/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers_test.go index 01eb4a71..6375cee2 100644 --- a/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers_test.go +++ b/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers_test.go @@ -27,37 +27,37 @@ func Test_Problem992(t *testing.T) { qs := []question992{ - question992{ + { para992{[]int{1, 1, 1, 1, 1, 1, 1, 1}, 1}, ans992{36}, }, - question992{ + { para992{[]int{2, 1, 1, 1, 2}, 1}, ans992{8}, }, - question992{ + { para992{[]int{1, 2}, 1}, ans992{2}, }, - question992{ + { para992{[]int{1, 2, 1, 2, 3}, 2}, ans992{7}, }, - question992{ + { para992{[]int{1, 2, 1, 3, 4}, 3}, ans992{3}, }, - question992{ + { para992{[]int{1}, 5}, ans992{1}, }, - question992{ + { para992{[]int{}, 10}, ans992{0}, }, diff --git a/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go b/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go index 4fb6a863..d0afbfc4 100644 --- a/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go +++ b/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go @@ -30,17 +30,17 @@ func Test_Problem993(t *testing.T) { qs := []question993{ - question993{ + { para993{[]int{1, 2, 3, 4}, 4, 3}, ans993{false}, }, - question993{ + { para993{[]int{1, 2, 3, structures.NULL, 4, structures.NULL, 5}, 5, 4}, ans993{true}, }, - question993{ + { para993{[]int{1, 2, 3, structures.NULL, 4}, 2, 3}, ans993{false}, }, diff --git a/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips_test.go b/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips_test.go index 9027b10c..41955d86 100644 --- a/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips_test.go +++ b/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips_test.go @@ -27,17 +27,17 @@ func Test_Problem995(t *testing.T) { qs := []question995{ - question995{ + { para995{[]int{0, 1, 0}, 1}, ans995{2}, }, - question995{ + { para995{[]int{1, 1, 0}, 2}, ans995{-1}, }, - question995{ + { para995{[]int{0, 0, 0, 1, 0, 1, 1, 0}, 3}, ans995{3}, }, diff --git a/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go b/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go index 5e65695d..030e1fb9 100644 --- a/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go +++ b/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go @@ -26,22 +26,22 @@ func Test_Problem996(t *testing.T) { qs := []question996{ - question996{ + { para996{[]int{1, 17, 8}}, ans996{2}, }, - question996{ + { para996{[]int{1}}, ans996{1}, }, - question996{ + { para996{[]int{2, 2, 2}}, ans996{1}, }, - question996{ + { para996{[]int{51768, 47861, 48143, 33221, 50893, 56758, 39946, 10312, 20276, 40616, 43633}}, ans996{1}, }, diff --git a/leetcode/0999.Available-Captures-for-Rook/999. Available Captures for Rook_test.go b/leetcode/0999.Available-Captures-for-Rook/999. Available Captures for Rook_test.go index c1057702..9c6bb712 100644 --- a/leetcode/0999.Available-Captures-for-Rook/999. Available Captures for Rook_test.go +++ b/leetcode/0999.Available-Captures-for-Rook/999. Available Captures for Rook_test.go @@ -26,44 +26,44 @@ func Test_Problem999(t *testing.T) { qs := []question999{ - question999{ + { para999{[][]byte{ - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', 'p', 'p', 'p', 'p', 'p', '.', '.'}, - []byte{'.', 'p', 'p', 'B', 'p', 'p', '.', '.'}, - []byte{'.', 'p', 'B', 'R', 'B', 'p', '.', '.'}, - []byte{'.', 'p', 'p', 'B', 'p', 'p', '.', '.'}, - []byte{'.', 'p', 'p', 'p', 'p', 'p', '.', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', 'p', 'p', 'p', 'p', 'p', '.', '.'}, + {'.', 'p', 'p', 'B', 'p', 'p', '.', '.'}, + {'.', 'p', 'B', 'R', 'B', 'p', '.', '.'}, + {'.', 'p', 'p', 'B', 'p', 'p', '.', '.'}, + {'.', 'p', 'p', 'p', 'p', 'p', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, }}, ans999{0}, }, - question999{ + { para999{[][]byte{ - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'p', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'R', '.', '.', '.', 'p'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'p', '.', '.', '.', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', 'p', '.', '.', '.', '.'}, + {'.', '.', '.', 'R', '.', '.', '.', 'p'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', 'p', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, }}, ans999{3}, }, - question999{ + { para999{[][]byte{ - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'p', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'p', '.', '.', '.', '.'}, - []byte{'p', 'p', '.', 'R', '.', 'p', 'B', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'B', '.', '.', '.', '.'}, - []byte{'.', '.', '.', 'p', '.', '.', '.', '.'}, - []byte{'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', 'p', '.', '.', '.', '.'}, + {'.', '.', '.', 'p', '.', '.', '.', '.'}, + {'p', 'p', '.', 'R', '.', 'p', 'B', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', 'B', '.', '.', '.', '.'}, + {'.', '.', '.', 'p', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.'}, }}, ans999{3}, }, diff --git a/leetcode/1002.Find-Common-Characters/1002. Find Common Characters_test.go b/leetcode/1002.Find-Common-Characters/1002. Find Common Characters_test.go index 284ac09b..e03e8a6a 100644 --- a/leetcode/1002.Find-Common-Characters/1002. Find Common Characters_test.go +++ b/leetcode/1002.Find-Common-Characters/1002. Find Common Characters_test.go @@ -26,12 +26,12 @@ func Test_Problem1002(t *testing.T) { qs := []question1002{ - question1002{ + { para1002{[]string{"bella", "label", "roller"}}, ans1002{[]string{"e", "l", "l"}}, }, - question1002{ + { para1002{[]string{"cool", "lock", "cook"}}, ans1002{[]string{"c", "o"}}, }, diff --git a/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go b/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go index d0437941..a59ff8a2 100644 --- a/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go +++ b/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go @@ -26,22 +26,22 @@ func Test_Problem1003(t *testing.T) { qs := []question1003{ - question1003{ + { para1003{"aabcbc"}, ans1003{true}, }, - question1003{ + { para1003{"abcabcababcc"}, ans1003{true}, }, - question1003{ + { para1003{"abccba"}, ans1003{false}, }, - question1003{ + { para1003{"cababc"}, ans1003{false}, }, diff --git a/leetcode/1004.Max-Consecutive-Ones-III/1004. Max Consecutive Ones III_test.go b/leetcode/1004.Max-Consecutive-Ones-III/1004. Max Consecutive Ones III_test.go index 01e28d13..59f81473 100644 --- a/leetcode/1004.Max-Consecutive-Ones-III/1004. Max Consecutive Ones III_test.go +++ b/leetcode/1004.Max-Consecutive-Ones-III/1004. Max Consecutive Ones III_test.go @@ -27,17 +27,17 @@ func Test_Problem1004(t *testing.T) { qs := []question1004{ - question1004{ + { para1004{[]int{1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0}, 2}, ans1004{6}, }, - question1004{ + { para1004{[]int{0, 0, 1, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1}, 3}, ans1004{10}, }, - question1004{ + { para1004{[]int{0, 0, 0, 1}, 4}, ans1004{4}, }, diff --git a/leetcode/1005.Maximize-Sum-Of-Array-After-K-Negations/1005. Maximize Sum Of Array After K Negations_test.go b/leetcode/1005.Maximize-Sum-Of-Array-After-K-Negations/1005. Maximize Sum Of Array After K Negations_test.go index 9e256ecd..1b16fdb2 100644 --- a/leetcode/1005.Maximize-Sum-Of-Array-After-K-Negations/1005. Maximize Sum Of Array After K Negations_test.go +++ b/leetcode/1005.Maximize-Sum-Of-Array-After-K-Negations/1005. Maximize Sum Of Array After K Negations_test.go @@ -27,36 +27,36 @@ func Test_Problem1005(t *testing.T) { qs := []question1005{ - question1005{ + { para1005{[]int{4, 2, 3}, 1}, ans1005{5}, }, - question1005{ + { para1005{[]int{3, -1, 0, 2}, 3}, ans1005{6}, }, - question1005{ + { para1005{[]int{2, -3, -1, 5, -4}, 2}, ans1005{13}, }, - question1005{ + { para1005{[]int{-2, 9, 9, 8, 4}, 5}, ans1005{32}, }, - question1005{ + { para1005{[]int{5, -7, -8, -3, 9, 5, -5, -7}, 7}, ans1005{49}, }, - question1005{ + { para1005{[]int{5, 6, 9, -3, 3}, 2}, ans1005{20}, }, - question1005{ + { para1005{[]int{8, -7, -3, -9, 1, 9, -6, -9, 3}, 8}, ans1005{53}, }, diff --git a/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go b/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go index 6251d2af..a7e359d6 100644 --- a/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go +++ b/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go @@ -27,22 +27,22 @@ func Test_Problem1011(t *testing.T) { qs := []question1011{ - question1011{ + { para1011{[]int{7, 2, 5, 10, 8}, 2}, ans1011{18}, }, - question1011{ + { para1011{[]int{1, 2, 3, 4, 5, 6, 7, 8, 9, 10}, 5}, ans1011{15}, }, - question1011{ + { para1011{[]int{3, 2, 2, 4, 1, 4}, 3}, ans1011{6}, }, - question1011{ + { para1011{[]int{1, 2, 3, 1, 1}, 4}, ans1011{3}, }, diff --git a/leetcode/1017.Convert-to-Base--2/1017. Convert to Base -2_test.go b/leetcode/1017.Convert-to-Base--2/1017. Convert to Base -2_test.go index f016c590..0bcf767d 100644 --- a/leetcode/1017.Convert-to-Base--2/1017. Convert to Base -2_test.go +++ b/leetcode/1017.Convert-to-Base--2/1017. Convert to Base -2_test.go @@ -26,17 +26,17 @@ func Test_Problem1017(t *testing.T) { qs := []question1017{ - question1017{ + { para1017{2}, ans1017{"110"}, }, - question1017{ + { para1017{3}, ans1017{"111"}, }, - question1017{ + { para1017{4}, ans1017{"110"}, }, diff --git a/leetcode/1019.Next-Greater-Node-In-Linked-List/1019. Next Greater Node In Linked List_test.go b/leetcode/1019.Next-Greater-Node-In-Linked-List/1019. Next Greater Node In Linked List_test.go index c59589d8..d6b0f68b 100644 --- a/leetcode/1019.Next-Greater-Node-In-Linked-List/1019. Next Greater Node In Linked List_test.go +++ b/leetcode/1019.Next-Greater-Node-In-Linked-List/1019. Next Greater Node In Linked List_test.go @@ -28,22 +28,22 @@ func Test_Problem1019(t *testing.T) { qs := []question1019{ - question1019{ + { para1019{[]int{2, 1, 5}}, ans1019{[]int{5, 5, 0}}, }, - question1019{ + { para1019{[]int{2, 7, 4, 3, 5}}, ans1019{[]int{7, 0, 5, 5, 0}}, }, - question1019{ + { para1019{[]int{1, 7, 5, 1, 9, 2, 5, 1}}, ans1019{[]int{7, 9, 9, 9, 0, 5, 0, 0}}, }, - question1019{ + { para1019{[]int{1, 7, 5, 1, 9, 2, 5, 6, 7, 8, 1}}, ans1019{[]int{7, 9, 9, 9, 0, 5, 6, 7, 8, 0, 0}}, }, diff --git a/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves.go b/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves.go index ca0daa9a..1e69fd73 100644 --- a/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves.go +++ b/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func numEnclaves(A [][]int) int { diff --git a/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves_test.go b/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves_test.go index 00ab5447..1aa7b5dc 100644 --- a/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves_test.go +++ b/leetcode/1020.Number-of-Enclaves/1020. Number of Enclaves_test.go @@ -26,55 +26,55 @@ func Test_Problem1020(t *testing.T) { qs := []question1020{ - question1020{ + { para1020{[][]int{ - []int{1, 1, 1, 1, 0}, - []int{1, 1, 0, 1, 0}, - []int{1, 1, 0, 0, 0}, - []int{0, 0, 0, 0, 0}, + {1, 1, 1, 1, 0}, + {1, 1, 0, 1, 0}, + {1, 1, 0, 0, 0}, + {0, 0, 0, 0, 0}, }}, ans1020{0}, }, - question1020{ + { para1020{[][]int{ - []int{1, 1, 0, 0, 0}, - []int{1, 1, 0, 0, 0}, - []int{0, 0, 1, 0, 0}, - []int{0, 0, 0, 1, 1}, + {1, 1, 0, 0, 0}, + {1, 1, 0, 0, 0}, + {0, 0, 1, 0, 0}, + {0, 0, 0, 1, 1}, }}, ans1020{1}, }, - question1020{ + { para1020{[][]int{ - []int{1, 1, 1, 1, 1, 1, 1, 0}, - []int{1, 0, 0, 0, 0, 1, 1, 0}, - []int{1, 0, 1, 0, 1, 1, 1, 0}, - []int{1, 0, 0, 0, 0, 1, 0, 1}, - []int{1, 1, 1, 1, 1, 1, 1, 0}, + {1, 1, 1, 1, 1, 1, 1, 0}, + {1, 0, 0, 0, 0, 1, 1, 0}, + {1, 0, 1, 0, 1, 1, 1, 0}, + {1, 0, 0, 0, 0, 1, 0, 1}, + {1, 1, 1, 1, 1, 1, 1, 0}, }}, ans1020{1}, }, - question1020{ + { para1020{[][]int{ - []int{0, 0, 1, 0, 0}, - []int{0, 1, 0, 1, 0}, - []int{0, 1, 1, 1, 0}, + {0, 0, 1, 0, 0}, + {0, 1, 0, 1, 0}, + {0, 1, 1, 1, 0}, }}, ans1020{0}, }, - question1020{ + { para1020{[][]int{ - []int{1, 1, 1, 1, 1, 1, 1}, - []int{1, 0, 0, 0, 0, 0, 1}, - []int{1, 0, 1, 1, 1, 0, 1}, - []int{1, 0, 1, 0, 1, 0, 1}, - []int{1, 0, 1, 1, 1, 0, 1}, - []int{1, 0, 0, 0, 0, 0, 1}, - []int{1, 1, 1, 1, 1, 1, 1}, + {1, 1, 1, 1, 1, 1, 1}, + {1, 0, 0, 0, 0, 0, 1}, + {1, 0, 1, 1, 1, 0, 1}, + {1, 0, 1, 0, 1, 0, 1}, + {1, 0, 1, 1, 1, 0, 1}, + {1, 0, 0, 0, 0, 0, 1}, + {1, 1, 1, 1, 1, 1, 1}, }}, ans1020{8}, }, diff --git a/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses_test.go b/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses_test.go index 828ffd32..5c72a5d0 100644 --- a/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses_test.go +++ b/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses_test.go @@ -25,17 +25,17 @@ type ans1021 struct { func Test_Problem1021(t *testing.T) { qs := []question1021{ - question1021{ + { para1021{"(()())(())"}, ans1021{"()()()"}, }, - question1021{ + { para1021{"(()())(())(()(()))"}, ans1021{"()()()()(())"}, }, - question1021{ + { para1021{"()()"}, ans1021{""}, }, diff --git a/leetcode/1025.Divisor-Game/1025. Divisor Game_test.go b/leetcode/1025.Divisor-Game/1025. Divisor Game_test.go index ab48e304..3ea6237d 100644 --- a/leetcode/1025.Divisor-Game/1025. Divisor Game_test.go +++ b/leetcode/1025.Divisor-Game/1025. Divisor Game_test.go @@ -25,12 +25,12 @@ type ans1025 struct { func Test_Problem1025(t *testing.T) { qs := []question1025{ - question1025{ + { para1025{2}, ans1025{true}, }, - question1025{ + { para1025{3}, ans1025{false}, }, diff --git a/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor_test.go b/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor_test.go index cdfbb730..5596f600 100644 --- a/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor_test.go +++ b/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor_test.go @@ -28,22 +28,22 @@ func Test_Problem1026(t *testing.T) { qs := []question1026{ - question1026{ + { para1026{[]int{}}, ans1026{0}, }, - question1026{ + { para1026{[]int{8, 3, 10, 1, 6, structures.NULL, 14, structures.NULL, structures.NULL, 4, 7, 13}}, ans1026{7}, }, - question1026{ + { para1026{[]int{7, 6, 4, 3, 1}}, ans1026{6}, }, - question1026{ + { para1026{[]int{1, 3, 2, 8, 4, 9}}, ans1026{8}, }, diff --git a/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go b/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go index 627dfedb..880213e4 100644 --- a/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go +++ b/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go @@ -27,17 +27,17 @@ type ans1028 struct { func Test_Problem1028(t *testing.T) { qs := []question1028{ - question1028{ + { para1028{"1-2--3--4-5--6--7"}, ans1028{[]int{1, 2, 5, 3, 4, 6, 7}}, }, - question1028{ + { para1028{"1-2--3---4-5--6---7"}, ans1028{[]int{1, 2, 5, 3, structures.NULL, 6, structures.NULL, 4, structures.NULL, 7}}, }, - question1028{ + { para1028{"1-401--349---90--88"}, ans1028{[]int{1, 401, structures.NULL, 349, 88, 90}}, }, diff --git a/leetcode/1030.Matrix-Cells-in-Distance-Order/1030. Matrix Cells in Distance Order_test.go b/leetcode/1030.Matrix-Cells-in-Distance-Order/1030. Matrix Cells in Distance Order_test.go index 91d8597f..5f6a07a6 100644 --- a/leetcode/1030.Matrix-Cells-in-Distance-Order/1030. Matrix Cells in Distance Order_test.go +++ b/leetcode/1030.Matrix-Cells-in-Distance-Order/1030. Matrix Cells in Distance Order_test.go @@ -29,19 +29,19 @@ func Test_Problem1030(t *testing.T) { qs := []question1030{ - question1030{ + { para1030{1, 2, 0, 0}, - ans1030{[][]int{[]int{0, 0}, []int{0, 1}}}, + ans1030{[][]int{{0, 0}, {0, 1}}}, }, - question1030{ + { para1030{2, 2, 0, 1}, - ans1030{[][]int{[]int{0, 1}, []int{0, 0}, []int{1, 1}, []int{1, 0}}}, + ans1030{[][]int{{0, 1}, {0, 0}, {1, 1}, {1, 0}}}, }, - question1030{ + { para1030{2, 3, 1, 2}, - ans1030{[][]int{[]int{1, 2}, []int{0, 2}, []int{1, 1}, []int{0, 1}, []int{1, 0}, []int{0, 0}}}, + ans1030{[][]int{{1, 2}, {0, 2}, {1, 1}, {0, 1}, {1, 0}, {0, 0}}}, }, } diff --git a/leetcode/1037.Valid-Boomerang/1037. Valid Boomerang_test.go b/leetcode/1037.Valid-Boomerang/1037. Valid Boomerang_test.go index db7b4c52..2d451a89 100644 --- a/leetcode/1037.Valid-Boomerang/1037. Valid Boomerang_test.go +++ b/leetcode/1037.Valid-Boomerang/1037. Valid Boomerang_test.go @@ -25,13 +25,13 @@ type ans1037 struct { func Test_Problem1037(t *testing.T) { qs := []question1037{ - question1037{ - para1037{[][]int{[]int{1, 2}, []int{2, 3}, []int{3, 2}}}, + { + para1037{[][]int{{1, 2}, {2, 3}, {3, 2}}}, ans1037{true}, }, - question1037{ - para1037{[][]int{[]int{1, 1}, []int{2, 2}, []int{3, 3}}}, + { + para1037{[][]int{{1, 1}, {2, 2}, {3, 3}}}, ans1037{false}, }, } diff --git a/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go b/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go index baf69382..0bed6999 100644 --- a/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go +++ b/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go @@ -25,22 +25,22 @@ type ans1040 struct { func Test_Problem1040(t *testing.T) { qs := []question1040{ - question1040{ + { para1040{[]int{7, 4, 9}}, ans1040{[]int{1, 2}}, }, - question1040{ + { para1040{[]int{6, 5, 4, 3, 10}}, ans1040{[]int{2, 3}}, }, - question1040{ + { para1040{[]int{100, 101, 104, 102, 103}}, ans1040{[]int{0, 0}}, }, - question1040{ + { para1040{[]int{1, 3, 5, 7, 10}}, ans1040{[]int{2, 4}}, }, diff --git a/leetcode/1047.Remove-All-Adjacent-Duplicates-In-String/1047. Remove All Adjacent Duplicates In String_test.go b/leetcode/1047.Remove-All-Adjacent-Duplicates-In-String/1047. Remove All Adjacent Duplicates In String_test.go index e57c00cf..f11061a7 100644 --- a/leetcode/1047.Remove-All-Adjacent-Duplicates-In-String/1047. Remove All Adjacent Duplicates In String_test.go +++ b/leetcode/1047.Remove-All-Adjacent-Duplicates-In-String/1047. Remove All Adjacent Duplicates In String_test.go @@ -26,7 +26,7 @@ func Test_Problem1047(t *testing.T) { qs := []question1047{ - question1047{ + { para1047{"abbaca"}, ans1047{"ca"}, }, diff --git a/leetcode/1049.Last-Stone-Weight-II/1049. Last Stone Weight II_test.go b/leetcode/1049.Last-Stone-Weight-II/1049. Last Stone Weight II_test.go index 0084f922..34b2847d 100644 --- a/leetcode/1049.Last-Stone-Weight-II/1049. Last Stone Weight II_test.go +++ b/leetcode/1049.Last-Stone-Weight-II/1049. Last Stone Weight II_test.go @@ -26,17 +26,17 @@ func Test_Problem1049(t *testing.T) { qs := []question1049{ - question1049{ + { para1049{[]int{2, 7, 4, 1, 8, 1}}, ans1049{1}, }, - question1049{ + { para1049{[]int{21, 26, 31, 33, 40}}, ans1049{5}, }, - question1049{ + { para1049{[]int{1, 2}}, ans1049{1}, }, diff --git a/leetcode/1051.Height-Checker/1051. Height Checker_test.go b/leetcode/1051.Height-Checker/1051. Height Checker_test.go index 43423ace..dc4c576c 100644 --- a/leetcode/1051.Height-Checker/1051. Height Checker_test.go +++ b/leetcode/1051.Height-Checker/1051. Height Checker_test.go @@ -26,22 +26,22 @@ func Test_Problem1051(t *testing.T) { qs := []question1051{ - question1051{ + { para1051{[]int{1, 1, 4, 2, 1, 3}}, ans1051{3}, }, - question1051{ + { para1051{[]int{5, 1, 2, 3, 4}}, ans1051{5}, }, - question1051{ + { para1051{[]int{1, 2, 3, 4, 5}}, ans1051{0}, }, - question1051{ + { para1051{[]int{5, 4, 3, 2, 1}}, ans1051{4}, }, diff --git a/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner_test.go b/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner_test.go index 327c5875..c0e84811 100644 --- a/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner_test.go +++ b/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner_test.go @@ -28,17 +28,17 @@ func Test_Problem1052(t *testing.T) { qs := []question1052{ - question1052{ + { para1052{[]int{4, 10, 10}, []int{1, 1, 0}, 2}, ans1052{24}, }, - question1052{ + { para1052{[]int{1}, []int{0}, 1}, ans1052{1}, }, - question1052{ + { para1052{[]int{1, 0, 1, 2, 1, 1, 7, 5}, []int{0, 1, 0, 1, 0, 1, 0, 1}, 3}, ans1052{16}, }, diff --git a/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go b/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go index 805075ce..118e2304 100644 --- a/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go +++ b/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go @@ -26,12 +26,12 @@ func Test_Problem1054(t *testing.T) { qs := []question1054{ - question1054{ + { para1054{[]int{1, 1, 1, 2, 2, 2}}, ans1054{[]int{2, 1, 2, 1, 2, 1}}, }, - question1054{ + { para1054{[]int{1, 1, 1, 1, 2, 2, 3, 3}}, ans1054{[]int{1, 3, 1, 3, 2, 1, 2, 1}}, }, diff --git a/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go b/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go index bf65c5fe..74386dd4 100644 --- a/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go +++ b/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go @@ -27,33 +27,33 @@ func Test_Problem1073(t *testing.T) { qs := []question1073{ - question1073{ + { para1073{[]int{1, 0, 0, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0}, []int{1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1}}, ans1073{[]int{1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1}}, }, - question1073{ + { para1073{[]int{0}, []int{1, 0, 0, 1}}, ans1073{[]int{1, 0, 0, 1}}, }, - question1073{ + { para1073{[]int{0}, []int{1, 1}}, ans1073{[]int{1, 1}}, }, - question1073{ + { para1073{[]int{1, 1, 1, 1, 1}, []int{1, 0, 1}}, ans1073{[]int{1, 0, 0, 0, 0}}, }, - question1073{ + { para1073{[]int{0}, []int{0}}, ans1073{[]int{0}}, }, - question1073{ + { para1073{[]int{0}, []int{1, 0}}, ans1073{[]int{1, 0}}, }, diff --git a/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target_test.go b/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target_test.go index af070664..0b77d021 100644 --- a/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target_test.go +++ b/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target_test.go @@ -27,13 +27,13 @@ func Test_Problem1074(t *testing.T) { qs := []question1074{ - question1074{ - para1074{[][]int{[]int{0, 1, 0}, []int{1, 1, 1}, []int{0, 1, 0}}, 0}, + { + para1074{[][]int{{0, 1, 0}, {1, 1, 1}, {0, 1, 0}}, 0}, ans1074{4}, }, - question1074{ - para1074{[][]int{[]int{1, -1}, []int{-1, 1}}, 0}, + { + para1074{[][]int{{1, -1}, {-1, 1}}, 0}, ans1074{5}, }, } diff --git a/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go b/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go index 020d3627..1c45d4a9 100644 --- a/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go +++ b/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go @@ -28,12 +28,12 @@ func Test_Problem1078(t *testing.T) { qs := []question1078{ - question1078{ + { para1078{"alice is a good girl she is a good student", "a", "good"}, ans1078{[]string{"girl", "student"}}, }, - question1078{ + { para1078{"we will we will rock you", "we", "will"}, ans1078{[]string{"we", "rock"}}, }, diff --git a/leetcode/1079.Letter-Tile-Possibilities/1079. Letter Tile Possibilities_test.go b/leetcode/1079.Letter-Tile-Possibilities/1079. Letter Tile Possibilities_test.go index f477a5b9..5b01d706 100644 --- a/leetcode/1079.Letter-Tile-Possibilities/1079. Letter Tile Possibilities_test.go +++ b/leetcode/1079.Letter-Tile-Possibilities/1079. Letter Tile Possibilities_test.go @@ -26,12 +26,12 @@ func Test_Problem1079(t *testing.T) { qs := []question1079{ - question1079{ + { para1079{"AAB"}, ans1079{8}, }, - question1079{ + { para1079{"AAABBC"}, ans1079{188}, }, diff --git a/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros_test.go b/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros_test.go index 35e37bd7..3916f0d0 100644 --- a/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros_test.go +++ b/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros_test.go @@ -25,17 +25,17 @@ func Test_Problem1089(t *testing.T) { qs := []question1089{ - question1089{ + { para1089{[]int{1, 0, 0, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0}}, ans1089{}, }, - question1089{ + { para1089{[]int{1, 0, 2, 3, 0, 4, 5, 0}}, ans1089{}, }, - question1089{ + { para1089{[]int{1, 2, 3}}, ans1089{}, }, diff --git a/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample_test.go b/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample_test.go index c6c45af2..204ac353 100644 --- a/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample_test.go +++ b/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample_test.go @@ -26,12 +26,12 @@ func Test_Problem1093(t *testing.T) { qs := []question1093{ - question1093{ + { para1093{[]int{0, 1, 3, 4, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}}, ans1093{[]float64{1.00000, 3.00000, 2.37500, 2.50000, 3.00000}}, }, - question1093{ + { para1093{[]int{0, 4, 3, 2, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}}, ans1093{[]float64{1.00000, 4.00000, 2.18182, 2.00000, 1.00000}}, }, diff --git a/leetcode/1105.Filling-Bookcase-Shelves/1105. Filling Bookcase Shelves_test.go b/leetcode/1105.Filling-Bookcase-Shelves/1105. Filling Bookcase Shelves_test.go index 5bd9d4c8..f3813ab8 100644 --- a/leetcode/1105.Filling-Bookcase-Shelves/1105. Filling Bookcase Shelves_test.go +++ b/leetcode/1105.Filling-Bookcase-Shelves/1105. Filling Bookcase Shelves_test.go @@ -27,8 +27,8 @@ func Test_Problem1105(t *testing.T) { qs := []question1105{ - question1105{ - para1105{[][]int{[]int{1, 1}, []int{2, 3}, []int{2, 3}, []int{1, 1}, []int{1, 1}, []int{1, 1}, []int{1, 2}}, 4}, + { + para1105{[][]int{{1, 1}, {2, 3}, {2, 3}, {1, 1}, {1, 1}, {1, 1}, {1, 2}}, 4}, ans1105{6}, }, } diff --git a/leetcode/1108.Defanging-an-IP-Address/1108. Defanging an IP Address_test.go b/leetcode/1108.Defanging-an-IP-Address/1108. Defanging an IP Address_test.go index 03232f09..9580433f 100644 --- a/leetcode/1108.Defanging-an-IP-Address/1108. Defanging an IP Address_test.go +++ b/leetcode/1108.Defanging-an-IP-Address/1108. Defanging an IP Address_test.go @@ -26,12 +26,12 @@ func Test_Problem1108(t *testing.T) { qs := []question1108{ - question1108{ + { para1108{"1.1.1.1"}, ans1108{"1[.]1[.]1[.]1"}, }, - question1108{ + { para1108{"255.100.50.0"}, ans1108{"255[.]100[.]50[.]0"}, }, diff --git a/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go b/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go index db4bebb5..da8c70c4 100644 --- a/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go +++ b/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go @@ -29,9 +29,9 @@ func Test_Problem1110(t *testing.T) { qs := []question1110{ - question1110{ + { para1110{[]int{1, 2, 3, 4, 5, 6, 7}, []int{3, 5}}, - ans1110{[][]int{[]int{1, 2, structures.NULL, 4}, []int{6}, []int{7}}}, + ans1110{[][]int{{1, 2, structures.NULL, 4}, {6}, {7}}}, }, } diff --git a/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings_test.go b/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings_test.go index fffc33e8..332e8849 100644 --- a/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings_test.go +++ b/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings_test.go @@ -26,12 +26,12 @@ func Test_Problem1111(t *testing.T) { qs := []question1111{ - question1111{ + { para1111{"(()())"}, ans1111{[]int{0, 1, 1, 1, 1, 0}}, }, - question1111{ + { para1111{"()(())()"}, ans1111{[]int{0, 0, 0, 1, 1, 0, 1, 1}}, }, diff --git a/leetcode/1122.Relative-Sort-Array/1122. Relative Sort Array_test.go b/leetcode/1122.Relative-Sort-Array/1122. Relative Sort Array_test.go index 77684d59..8e53cf9a 100644 --- a/leetcode/1122.Relative-Sort-Array/1122. Relative Sort Array_test.go +++ b/leetcode/1122.Relative-Sort-Array/1122. Relative Sort Array_test.go @@ -27,7 +27,7 @@ func Test_Problem1122(t *testing.T) { qs := []question1122{ - question1122{ + { para1122{[]int{2, 3, 1, 3, 2, 4, 6, 7, 9, 2, 19}, []int{2, 1, 4, 3, 9, 6}}, ans1122{[]int{2, 2, 2, 1, 4, 3, 3, 9, 6, 7, 19}}, }, diff --git a/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves_test.go b/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves_test.go index 9f694a2a..5debb691 100644 --- a/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves_test.go +++ b/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves_test.go @@ -28,32 +28,32 @@ func Test_Problem1123(t *testing.T) { qs := []question1123{ - question1123{ + { para1123{[]int{}}, ans1123{[]int{}}, }, - question1123{ + { para1123{[]int{1}}, ans1123{[]int{1}}, }, - question1123{ + { para1123{[]int{1, 2, 3, 4}}, ans1123{[]int{4}}, }, - question1123{ + { para1123{[]int{1, 2, 3}}, ans1123{[]int{1, 2, 3}}, }, - question1123{ + { para1123{[]int{1, 2, 3, 4, 5}}, ans1123{[]int{2, 4, 5}}, }, - question1123{ + { para1123{[]int{1, 2, structures.NULL, 3, 4, structures.NULL, 6, structures.NULL, 5}}, ans1123{[]int{2, 3, 4, structures.NULL, 6, structures.NULL, 5}}, }, diff --git a/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go b/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go index 484f79eb..efb82053 100644 --- a/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go +++ b/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go @@ -26,8 +26,8 @@ func Test_Problem1128(t *testing.T) { qs := []question1128{ - question1128{ - para1128{[][]int{[]int{1, 2}, []int{2, 1}, []int{3, 4}, []int{5, 6}}}, + { + para1128{[][]int{{1, 2}, {2, 1}, {3, 4}, {5, 6}}}, ans1128{1}, }, } diff --git a/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number_test.go b/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number_test.go index 3b0bce88..2546339e 100644 --- a/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number_test.go +++ b/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number_test.go @@ -26,27 +26,27 @@ func Test_Problem1137(t *testing.T) { qs := []question1137{ - question1137{ + { para1137{1}, ans1137{1}, }, - question1137{ + { para1137{2}, ans1137{1}, }, - question1137{ + { para1137{3}, ans1137{2}, }, - question1137{ + { para1137{4}, ans1137{4}, }, - question1137{ + { para1137{25}, ans1137{1389537}, }, diff --git a/leetcode/1145.Binary-Tree-Coloring-Game/1145. Binary Tree Coloring Game_test.go b/leetcode/1145.Binary-Tree-Coloring-Game/1145. Binary Tree Coloring Game_test.go index 964c8164..79b3f574 100644 --- a/leetcode/1145.Binary-Tree-Coloring-Game/1145. Binary Tree Coloring Game_test.go +++ b/leetcode/1145.Binary-Tree-Coloring-Game/1145. Binary Tree Coloring Game_test.go @@ -30,7 +30,7 @@ func Test_Problem1145(t *testing.T) { qs := []question1145{ - question1145{ + { para1145{[]int{1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11}, 11, 3}, ans1145{true}, }, diff --git a/leetcode/1154.Day-of-the-Year/1154. Day of the Year_test.go b/leetcode/1154.Day-of-the-Year/1154. Day of the Year_test.go index d9d83b60..cdd07c2c 100644 --- a/leetcode/1154.Day-of-the-Year/1154. Day of the Year_test.go +++ b/leetcode/1154.Day-of-the-Year/1154. Day of the Year_test.go @@ -26,22 +26,22 @@ func Test_Problem1154(t *testing.T) { qs := []question1154{ - question1154{ + { para1154{"2019-01-09"}, ans1154{9}, }, - question1154{ + { para1154{"2019-02-10"}, ans1154{41}, }, - question1154{ + { para1154{"2003-03-01"}, ans1154{60}, }, - question1154{ + { para1154{"2004-03-01"}, ans1154{61}, }, diff --git a/leetcode/1160.Find-Words-That-Can-Be-Formed-by-Characters/1160. Find Words That Can Be Formed by Characters_test.go b/leetcode/1160.Find-Words-That-Can-Be-Formed-by-Characters/1160. Find Words That Can Be Formed by Characters_test.go index 9549fcbe..7820fc52 100644 --- a/leetcode/1160.Find-Words-That-Can-Be-Formed-by-Characters/1160. Find Words That Can Be Formed by Characters_test.go +++ b/leetcode/1160.Find-Words-That-Can-Be-Formed-by-Characters/1160. Find Words That Can Be Formed by Characters_test.go @@ -27,12 +27,12 @@ func Test_Problem1160(t *testing.T) { qs := []question1160{ - question1160{ + { para1160{[]string{"cat", "bt", "hat", "tree"}, "atach"}, ans1160{6}, }, - question1160{ + { para1160{[]string{"hello", "world", "leetcode"}, "welldonehoneyr"}, ans1160{10}, }, diff --git a/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character_test.go b/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character_test.go index 03a70ee5..ea6e7105 100644 --- a/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character_test.go +++ b/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character_test.go @@ -27,12 +27,12 @@ func Test_Problem1170(t *testing.T) { qs := []question1170{ - question1170{ + { para1170{[]string{"cbd"}, []string{"zaaaz"}}, ans1170{[]int{1}}, }, - question1170{ + { para1170{[]string{"bbb", "cc"}, []string{"a", "aa", "aaa", "aaaa"}}, ans1170{[]int{1, 2}}, }, diff --git a/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go b/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go index d91b59d8..f6276900 100644 --- a/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go +++ b/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go @@ -28,22 +28,22 @@ func Test_Problem1171(t *testing.T) { qs := []question1171{ - question1171{ + { para1171{[]int{1, 2, -3, 3, 1}}, ans1171{[]int{3, 1}}, }, - question1171{ + { para1171{[]int{1, 2, 3, -3, 4}}, ans1171{[]int{1, 2, 4}}, }, - question1171{ + { para1171{[]int{1, 2, 3, -3, -2}}, ans1171{[]int{1}}, }, - question1171{ + { para1171{[]int{1, -1}}, ans1171{[]int{}}, }, diff --git a/leetcode/1175.Prime-Arrangements/1175. Prime Arrangements_test.go b/leetcode/1175.Prime-Arrangements/1175. Prime Arrangements_test.go index 37627f62..0bd25db6 100644 --- a/leetcode/1175.Prime-Arrangements/1175. Prime Arrangements_test.go +++ b/leetcode/1175.Prime-Arrangements/1175. Prime Arrangements_test.go @@ -26,17 +26,17 @@ func Test_Problem1175(t *testing.T) { qs := []question1175{ - question1175{ + { para1175{5}, ans1175{12}, }, - question1175{ + { para1175{99}, ans1175{75763854}, }, - question1175{ + { para1175{100}, ans1175{682289015}, }, diff --git a/leetcode/1184.Distance-Between-Bus-Stops/1184. Distance Between Bus Stops_test.go b/leetcode/1184.Distance-Between-Bus-Stops/1184. Distance Between Bus Stops_test.go index 9707cd7b..95391f94 100644 --- a/leetcode/1184.Distance-Between-Bus-Stops/1184. Distance Between Bus Stops_test.go +++ b/leetcode/1184.Distance-Between-Bus-Stops/1184. Distance Between Bus Stops_test.go @@ -28,17 +28,17 @@ func Test_Problem1184(t *testing.T) { qs := []question1184{ - question1184{ + { para1184{[]int{1, 2, 3, 4}, 0, 1}, ans1184{1}, }, - question1184{ + { para1184{[]int{1, 2, 3, 4}, 0, 2}, ans1184{3}, }, - question1184{ + { para1184{[]int{1, 2, 3, 4}, 0, 3}, ans1184{4}, }, diff --git a/leetcode/1185.Day-of-the-Week/1185. Day of the Week_test.go b/leetcode/1185.Day-of-the-Week/1185. Day of the Week_test.go index 53c67bd6..70728c1e 100644 --- a/leetcode/1185.Day-of-the-Week/1185. Day of the Week_test.go +++ b/leetcode/1185.Day-of-the-Week/1185. Day of the Week_test.go @@ -28,17 +28,17 @@ func Test_Problem1185(t *testing.T) { qs := []question1185{ - question1185{ + { para1185{31, 8, 2019}, ans1185{"Saturday"}, }, - question1185{ + { para1185{18, 7, 1999}, ans1185{"Sunday"}, }, - question1185{ + { para1185{15, 8, 1993}, ans1185{"Sunday"}, }, diff --git a/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go b/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go index 959338fb..1dcb110e 100644 --- a/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go +++ b/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go @@ -26,17 +26,17 @@ func Test_Problem1189(t *testing.T) { qs := []question1189{ - question1189{ + { para1189{"nlaebolko"}, ans1189{1}, }, - question1189{ + { para1189{"loonbalxballpoon"}, ans1189{2}, }, - question1189{ + { para1189{"leetcode"}, ans1189{0}, }, diff --git a/leetcode/1200.Minimum-Absolute-Difference/1200. Minimum Absolute Difference_test.go b/leetcode/1200.Minimum-Absolute-Difference/1200. Minimum Absolute Difference_test.go index 140377cd..6b24d92b 100644 --- a/leetcode/1200.Minimum-Absolute-Difference/1200. Minimum Absolute Difference_test.go +++ b/leetcode/1200.Minimum-Absolute-Difference/1200. Minimum Absolute Difference_test.go @@ -26,19 +26,19 @@ func Test_Problem1200(t *testing.T) { qs := []question1200{ - question1200{ + { para1200{[]int{4, 2, 1, 3}}, - ans1200{[][]int{[]int{1, 2}, []int{2, 3}, []int{3, 4}}}, + ans1200{[][]int{{1, 2}, {2, 3}, {3, 4}}}, }, - question1200{ + { para1200{[]int{1, 3, 6, 10, 15}}, - ans1200{[][]int{[]int{1, 3}}}, + ans1200{[][]int{{1, 3}}}, }, - question1200{ + { para1200{[]int{3, 8, -10, 23, 19, -4, -14, 27}}, - ans1200{[][]int{[]int{-14, -10}, []int{19, 23}, []int{23, 27}}}, + ans1200{[][]int{{-14, -10}, {19, 23}, {23, 27}}}, }, } diff --git a/leetcode/1201.Ugly-Number-III/1201. Ugly Number III_test.go b/leetcode/1201.Ugly-Number-III/1201. Ugly Number III_test.go index 45ec2229..5d5b501a 100644 --- a/leetcode/1201.Ugly-Number-III/1201. Ugly Number III_test.go +++ b/leetcode/1201.Ugly-Number-III/1201. Ugly Number III_test.go @@ -29,22 +29,22 @@ func Test_Problem1201(t *testing.T) { qs := []question1201{ - question1201{ + { para1201{3, 2, 3, 5}, ans1201{4}, }, - question1201{ + { para1201{4, 2, 3, 4}, ans1201{6}, }, - question1201{ + { para1201{5, 2, 11, 13}, ans1201{10}, }, - question1201{ + { para1201{1000000000, 2, 217983653, 336916467}, ans1201{1999999984}, }, diff --git a/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps.go b/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps.go index fdd79625..60ce722b 100644 --- a/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps.go +++ b/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps.go @@ -25,7 +25,7 @@ func smallestStringWithSwaps(s string, pairs [][]int) string { r := uf.Find(i) bytes := sMap[r] res[i] = bytes[0] - sMap[r] = bytes[1:len(bytes)] + sMap[r] = bytes[1:] } return string(res) } diff --git a/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps_test.go b/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps_test.go index 71030e52..8e123e77 100644 --- a/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps_test.go +++ b/leetcode/1202.Smallest-String-With-Swaps/1202. Smallest String With Swaps_test.go @@ -27,18 +27,18 @@ func Test_Problem1202(t *testing.T) { qs := []question1202{ - question1202{ - para1202{"dcab", [][]int{[]int{0, 3}, []int{1, 2}}}, + { + para1202{"dcab", [][]int{{0, 3}, {1, 2}}}, ans1202{"bacd"}, }, - question1202{ - para1202{"dcab", [][]int{[]int{0, 3}, []int{1, 2}, []int{0, 2}}}, + { + para1202{"dcab", [][]int{{0, 3}, {1, 2}, {0, 2}}}, ans1202{"abcd"}, }, - question1202{ - para1202{"cba", [][]int{[]int{0, 1}, []int{1, 2}}}, + { + para1202{"cba", [][]int{{0, 1}, {1, 2}}}, ans1202{"abc"}, }, } diff --git a/leetcode/1207.Unique-Number-of-Occurrences/1207. Unique Number of Occurrences_test.go b/leetcode/1207.Unique-Number-of-Occurrences/1207. Unique Number of Occurrences_test.go index 58d513b0..9f4728dc 100644 --- a/leetcode/1207.Unique-Number-of-Occurrences/1207. Unique Number of Occurrences_test.go +++ b/leetcode/1207.Unique-Number-of-Occurrences/1207. Unique Number of Occurrences_test.go @@ -26,17 +26,17 @@ func Test_Problem1207(t *testing.T) { qs := []question1207{ - question1207{ + { para1207{[]int{1, 2, 2, 1, 1, 3}}, ans1207{true}, }, - question1207{ + { para1207{[]int{1, 2}}, ans1207{false}, }, - question1207{ + { para1207{[]int{-3, 0, 1, -3, 1, 1, 1, -3, 10, 0}}, ans1207{true}, }, diff --git a/leetcode/1208.Get-Equal-Substrings-Within-Budget/1208. Get Equal Substrings Within Budget_test.go b/leetcode/1208.Get-Equal-Substrings-Within-Budget/1208. Get Equal Substrings Within Budget_test.go index 385f9e9b..86f50180 100644 --- a/leetcode/1208.Get-Equal-Substrings-Within-Budget/1208. Get Equal Substrings Within Budget_test.go +++ b/leetcode/1208.Get-Equal-Substrings-Within-Budget/1208. Get Equal Substrings Within Budget_test.go @@ -28,27 +28,27 @@ func Test_Problem1208(t *testing.T) { qs := []question1208{ - question1208{ + { para1208{"abcd", "bcdf", 3}, ans1208{3}, }, - question1208{ + { para1208{"abcd", "cdef", 3}, ans1208{1}, }, - question1208{ + { para1208{"abcd", "acde", 0}, ans1208{1}, }, - question1208{ + { para1208{"thjdoffka", "qhrnlntls", 11}, ans1208{3}, }, - question1208{ + { para1208{"krrgw", "zjxss", 19}, ans1208{2}, }, diff --git a/leetcode/1217.Play-with-Chips/1217. Play with Chips_test.go b/leetcode/1217.Play-with-Chips/1217. Play with Chips_test.go index ae0b1163..fcc7beca 100644 --- a/leetcode/1217.Play-with-Chips/1217. Play with Chips_test.go +++ b/leetcode/1217.Play-with-Chips/1217. Play with Chips_test.go @@ -26,12 +26,12 @@ func Test_Problem1217(t *testing.T) { qs := []question1217{ - question1217{ + { para1217{[]int{1, 2, 3}}, ans1217{1}, }, - question1217{ + { para1217{[]int{2, 2, 2, 3, 3}}, ans1217{2}, }, diff --git a/leetcode/1221.Split-a-String-in-Balanced-Strings/1221. Split a String in Balanced Strings_test.go b/leetcode/1221.Split-a-String-in-Balanced-Strings/1221. Split a String in Balanced Strings_test.go index ad546137..f5691c5e 100644 --- a/leetcode/1221.Split-a-String-in-Balanced-Strings/1221. Split a String in Balanced Strings_test.go +++ b/leetcode/1221.Split-a-String-in-Balanced-Strings/1221. Split a String in Balanced Strings_test.go @@ -26,17 +26,17 @@ func Test_Problem1221(t *testing.T) { qs := []question1221{ - question1221{ + { para1221{"RLRRLLRLRL"}, ans1221{4}, }, - question1221{ + { para1221{"RLLLLRRRLR"}, ans1221{3}, }, - question1221{ + { para1221{"LLLLRRRR"}, ans1221{1}, }, diff --git a/leetcode/1232.Check-If-It-Is-a-Straight-Line/1232. Check If It Is a Straight Line_test.go b/leetcode/1232.Check-If-It-Is-a-Straight-Line/1232. Check If It Is a Straight Line_test.go index 08423596..63710630 100644 --- a/leetcode/1232.Check-If-It-Is-a-Straight-Line/1232. Check If It Is a Straight Line_test.go +++ b/leetcode/1232.Check-If-It-Is-a-Straight-Line/1232. Check If It Is a Straight Line_test.go @@ -26,13 +26,13 @@ func Test_Problem1232(t *testing.T) { qs := []question1232{ - question1232{ - para1232{[][]int{[]int{1, 2}, []int{2, 3}, []int{3, 4}, []int{4, 5}, []int{5, 6}, []int{6, 7}}}, + { + para1232{[][]int{{1, 2}, {2, 3}, {3, 4}, {4, 5}, {5, 6}, {6, 7}}}, ans1232{true}, }, - question1232{ - para1232{[][]int{[]int{1, 1}, []int{2, 2}, []int{3, 4}, []int{4, 5}, []int{5, 6}, []int{7, 7}}}, + { + para1232{[][]int{{1, 1}, {2, 2}, {3, 4}, {4, 5}, {5, 6}, {7, 7}}}, ans1232{false}, }, } diff --git a/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String_test.go b/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String_test.go index 0a592723..854dc2bc 100644 --- a/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String_test.go +++ b/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String_test.go @@ -26,27 +26,27 @@ func Test_Problem1234(t *testing.T) { qs := []question1234{ - question1234{ + { para1234{"QWER"}, ans1234{0}, }, - question1234{ + { para1234{"QQWE"}, ans1234{1}, }, - question1234{ + { para1234{"QQQW"}, ans1234{2}, }, - question1234{ + { para1234{"QQQQ"}, ans1234{3}, }, - question1234{ + { para1234{"WQWRQQQW"}, ans1234{3}, }, diff --git a/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go b/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go index 65b49a7d..77501bf4 100644 --- a/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go +++ b/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go @@ -28,17 +28,17 @@ func Test_Problem1235(t *testing.T) { qs := []question1235{ - question1235{ + { para1235{[]int{1, 2, 3, 3}, []int{3, 4, 5, 6}, []int{50, 10, 40, 70}}, ans1235{120}, }, - question1235{ + { para1235{[]int{1, 2, 3, 4, 6}, []int{3, 5, 10, 6, 9}, []int{20, 20, 100, 70, 60}}, ans1235{150}, }, - question1235{ + { para1235{[]int{1, 1, 1}, []int{2, 3, 4}, []int{5, 6, 4}}, ans1235{6}, }, diff --git a/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix_test.go b/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix_test.go index 747aa7c8..df409893 100644 --- a/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix_test.go +++ b/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix_test.go @@ -28,13 +28,13 @@ func Test_Problem1252(t *testing.T) { qs := []question1252{ - question1252{ - para1252{2, 3, [][]int{[]int{0, 1}, []int{1, 1}}}, + { + para1252{2, 3, [][]int{{0, 1}, {1, 1}}}, ans1252{6}, }, - question1252{ - para1252{2, 2, [][]int{[]int{1, 1}, []int{0, 0}}}, + { + para1252{2, 2, [][]int{{1, 1}, {0, 0}}}, ans1252{0}, }, } diff --git a/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go b/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go index 18d6afe8..c7773dd6 100644 --- a/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go +++ b/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go @@ -1,10 +1,10 @@ package leetcode var dir = [][]int{ - []int{-1, 0}, - []int{0, 1}, - []int{1, 0}, - []int{0, -1}, + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, } func closedIsland(grid [][]int) int { diff --git a/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go b/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go index 5bce0d15..a91cfeab 100644 --- a/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go +++ b/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go @@ -26,55 +26,55 @@ func Test_Problem1254(t *testing.T) { qs := []question1254{ - question1254{ + { para1254{[][]int{ - []int{1, 1, 1, 1, 0}, - []int{1, 1, 0, 1, 0}, - []int{1, 1, 0, 0, 0}, - []int{0, 0, 0, 0, 0}, + {1, 1, 1, 1, 0}, + {1, 1, 0, 1, 0}, + {1, 1, 0, 0, 0}, + {0, 0, 0, 0, 0}, }}, ans1254{0}, }, - question1254{ + { para1254{[][]int{ - []int{1, 1, 0, 0, 0}, - []int{1, 1, 0, 0, 0}, - []int{0, 0, 1, 0, 0}, - []int{0, 0, 0, 1, 1}, + {1, 1, 0, 0, 0}, + {1, 1, 0, 0, 0}, + {0, 0, 1, 0, 0}, + {0, 0, 0, 1, 1}, }}, ans1254{0}, }, - question1254{ + { para1254{[][]int{ - []int{1, 1, 1, 1, 1, 1, 1, 0}, - []int{1, 0, 0, 0, 0, 1, 1, 0}, - []int{1, 0, 1, 0, 1, 1, 1, 0}, - []int{1, 0, 0, 0, 0, 1, 0, 1}, - []int{1, 1, 1, 1, 1, 1, 1, 0}, + {1, 1, 1, 1, 1, 1, 1, 0}, + {1, 0, 0, 0, 0, 1, 1, 0}, + {1, 0, 1, 0, 1, 1, 1, 0}, + {1, 0, 0, 0, 0, 1, 0, 1}, + {1, 1, 1, 1, 1, 1, 1, 0}, }}, ans1254{2}, }, - question1254{ + { para1254{[][]int{ - []int{0, 0, 1, 0, 0}, - []int{0, 1, 0, 1, 0}, - []int{0, 1, 1, 1, 0}, + {0, 0, 1, 0, 0}, + {0, 1, 0, 1, 0}, + {0, 1, 1, 1, 0}, }}, ans1254{1}, }, - question1254{ + { para1254{[][]int{ - []int{1, 1, 1, 1, 1, 1, 1}, - []int{1, 0, 0, 0, 0, 0, 1}, - []int{1, 0, 1, 1, 1, 0, 1}, - []int{1, 0, 1, 0, 1, 0, 1}, - []int{1, 0, 1, 1, 1, 0, 1}, - []int{1, 0, 0, 0, 0, 0, 1}, - []int{1, 1, 1, 1, 1, 1, 1}, + {1, 1, 1, 1, 1, 1, 1}, + {1, 0, 0, 0, 0, 0, 1}, + {1, 0, 1, 1, 1, 0, 1}, + {1, 0, 1, 0, 1, 0, 1}, + {1, 0, 1, 1, 1, 0, 1}, + {1, 0, 0, 0, 0, 0, 1}, + {1, 1, 1, 1, 1, 1, 1}, }}, ans1254{2}, }, diff --git a/leetcode/1260.Shift-2D-Grid/1260. Shift 2D Grid_test.go b/leetcode/1260.Shift-2D-Grid/1260. Shift 2D Grid_test.go index a26d7d84..8b4167e1 100644 --- a/leetcode/1260.Shift-2D-Grid/1260. Shift 2D Grid_test.go +++ b/leetcode/1260.Shift-2D-Grid/1260. Shift 2D Grid_test.go @@ -27,24 +27,24 @@ func Test_Problem1260(t *testing.T) { qs := []question1260{ - question1260{ - para1260{[][]int{[]int{3, 7, 8}, []int{9, 11, 13}, []int{15, 16, 17}}, 2}, - ans1260{[][]int{[]int{16, 17, 3}, []int{7, 8, 9}, []int{11, 13, 15}}}, + { + para1260{[][]int{{3, 7, 8}, {9, 11, 13}, {15, 16, 17}}, 2}, + ans1260{[][]int{{16, 17, 3}, {7, 8, 9}, {11, 13, 15}}}, }, - question1260{ - para1260{[][]int{[]int{1, 10, 4, 2}, []int{9, 3, 8, 7}, []int{15, 16, 17, 12}}, 10}, - ans1260{[][]int{[]int{4, 2, 9, 3}, []int{8, 7, 15, 16}, []int{17, 12, 1, 10}}}, + { + para1260{[][]int{{1, 10, 4, 2}, {9, 3, 8, 7}, {15, 16, 17, 12}}, 10}, + ans1260{[][]int{{4, 2, 9, 3}, {8, 7, 15, 16}, {17, 12, 1, 10}}}, }, - question1260{ - para1260{[][]int{[]int{3, 8, 1, 9}, []int{19, 7, 2, 5}, []int{4, 6, 11, 10}, []int{12, 0, 21, 13}}, 4}, - ans1260{[][]int{[]int{12, 0, 21, 13}, []int{3, 8, 1, 9}, []int{19, 7, 2, 5}, []int{4, 6, 11, 10}}}, + { + para1260{[][]int{{3, 8, 1, 9}, {19, 7, 2, 5}, {4, 6, 11, 10}, {12, 0, 21, 13}}, 4}, + ans1260{[][]int{{12, 0, 21, 13}, {3, 8, 1, 9}, {19, 7, 2, 5}, {4, 6, 11, 10}}}, }, - question1260{ - para1260{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}, []int{7, 8, 9}}, 9}, - ans1260{[][]int{[]int{1, 2, 3}, []int{4, 5, 6}, []int{7, 8, 9}}}, + { + para1260{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}, 9}, + ans1260{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}}, }, // 如需多个测试，可以复制上方元素。 } diff --git a/leetcode/1266.Minimum-Time-Visiting-All-Points/1266. Minimum Time Visiting All Points_test.go b/leetcode/1266.Minimum-Time-Visiting-All-Points/1266. Minimum Time Visiting All Points_test.go index 155a7dfb..95461646 100644 --- a/leetcode/1266.Minimum-Time-Visiting-All-Points/1266. Minimum Time Visiting All Points_test.go +++ b/leetcode/1266.Minimum-Time-Visiting-All-Points/1266. Minimum Time Visiting All Points_test.go @@ -26,13 +26,13 @@ func Test_Problem1266(t *testing.T) { qs := []question1266{ - question1266{ - para1266{[][]int{[]int{1, 1}, []int{3, 4}, []int{-1, 0}}}, + { + para1266{[][]int{{1, 1}, {3, 4}, {-1, 0}}}, ans1266{7}, }, - question1266{ - para1266{[][]int{[]int{3, 2}, []int{-2, 2}}}, + { + para1266{[][]int{{3, 2}, {-2, 2}}}, ans1266{5}, }, } diff --git a/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go b/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go index 360a9258..8502ddef 100644 --- a/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go +++ b/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go @@ -26,23 +26,23 @@ func Test_Problem1275(t *testing.T) { qs := []question1275{ - question1275{ - para1275{[][]int{[]int{0, 0}, []int{2, 0}, []int{1, 1}, []int{2, 1}, []int{2, 2}}}, + { + para1275{[][]int{{0, 0}, {2, 0}, {1, 1}, {2, 1}, {2, 2}}}, ans1275{"A"}, }, - question1275{ - para1275{[][]int{[]int{0, 0}, []int{1, 1}, []int{0, 1}, []int{0, 2}, []int{1, 0}, []int{2, 0}}}, + { + para1275{[][]int{{0, 0}, {1, 1}, {0, 1}, {0, 2}, {1, 0}, {2, 0}}}, ans1275{"B"}, }, - question1275{ - para1275{[][]int{[]int{0, 0}, []int{1, 1}, []int{2, 0}, []int{1, 0}, []int{1, 2}, []int{2, 1}, []int{0, 1}, []int{0, 2}, []int{2, 2}}}, + { + para1275{[][]int{{0, 0}, {1, 1}, {2, 0}, {1, 0}, {1, 2}, {2, 1}, {0, 1}, {0, 2}, {2, 2}}}, ans1275{"Draw"}, }, - question1275{ - para1275{[][]int{[]int{0, 0}, []int{1, 1}}}, + { + para1275{[][]int{{0, 0}, {1, 1}}}, ans1275{"Pending"}, }, } diff --git a/leetcode/1281.Subtract-the-Product-and-Sum-of-Digits-of-an-Integer/1281. Subtract the Product and Sum of Digits of an Integer_test.go b/leetcode/1281.Subtract-the-Product-and-Sum-of-Digits-of-an-Integer/1281. Subtract the Product and Sum of Digits of an Integer_test.go index 4c2ca800..ec98bb9f 100644 --- a/leetcode/1281.Subtract-the-Product-and-Sum-of-Digits-of-an-Integer/1281. Subtract the Product and Sum of Digits of an Integer_test.go +++ b/leetcode/1281.Subtract-the-Product-and-Sum-of-Digits-of-an-Integer/1281. Subtract the Product and Sum of Digits of an Integer_test.go @@ -26,12 +26,12 @@ func Test_Problem1281(t *testing.T) { qs := []question1281{ - question1281{ + { para1281{234}, ans1281{15}, }, - question1281{ + { para1281{4421}, ans1281{21}, }, diff --git a/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold_test.go b/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold_test.go index 24ef786a..e0bdbb27 100644 --- a/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold_test.go +++ b/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold_test.go @@ -27,17 +27,17 @@ func Test_Problem1283(t *testing.T) { qs := []question1283{ - question1283{ + { para1283{[]int{1, 2, 5, 9}, 6}, ans1283{5}, }, - question1283{ + { para1283{[]int{2, 3, 5, 7, 11}, 11}, ans1283{3}, }, - question1283{ + { para1283{[]int{19}, 5}, ans1283{4}, }, diff --git a/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go b/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go index 50edccd7..fe7cea6f 100644 --- a/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go +++ b/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go @@ -26,7 +26,7 @@ func Test_Problem1287(t *testing.T) { qs := []question1287{ - question1287{ + { para1287{[]int{1, 2, 2, 6, 6, 6, 6, 7, 10}}, ans1287{6}, }, diff --git a/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer_test.go b/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer_test.go index 83186bdf..0a509b58 100644 --- a/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer_test.go +++ b/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer_test.go @@ -28,27 +28,27 @@ func Test_Problem1290(t *testing.T) { qs := []question1290{ - question1290{ + { para1290{[]int{1, 0, 1}}, ans1290{5}, }, - question1290{ + { para1290{[]int{0}}, ans1290{0}, }, - question1290{ + { para1290{[]int{1}}, ans1290{1}, }, - question1290{ + { para1290{[]int{0, 0}}, ans1290{0}, }, - question1290{ + { para1290{[]int{1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0}}, ans1290{18880}, }, diff --git a/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits_test.go b/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits_test.go index 6f3cb6ec..df89aa0c 100644 --- a/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits_test.go +++ b/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits_test.go @@ -26,12 +26,12 @@ func Test_Problem1295(t *testing.T) { qs := []question1295{ - question1295{ + { para1295{[]int{12, 345, 2, 6, 7896}}, ans1295{2}, }, - question1295{ + { para1295{[]int{555, 901, 482, 1771}}, ans1295{1}, }, diff --git a/leetcode/1299.Replace-Elements-with-Greatest-Element-on-Right-Side/1299. Replace Elements with Greatest Element on Right Side_test.go b/leetcode/1299.Replace-Elements-with-Greatest-Element-on-Right-Side/1299. Replace Elements with Greatest Element on Right Side_test.go index 13c6ea81..d590320c 100644 --- a/leetcode/1299.Replace-Elements-with-Greatest-Element-on-Right-Side/1299. Replace Elements with Greatest Element on Right Side_test.go +++ b/leetcode/1299.Replace-Elements-with-Greatest-Element-on-Right-Side/1299. Replace Elements with Greatest Element on Right Side_test.go @@ -26,7 +26,7 @@ func Test_Problem1299(t *testing.T) { qs := []question1299{ - question1299{ + { para1299{[]int{17, 18, 5, 4, 6, 1}}, ans1299{[]int{18, 6, 6, 6, 1, -1}}, }, diff --git a/leetcode/1300.Sum-of-Mutated-Array-Closest-to-Target/1300. Sum of Mutated Array Closest to Target_test.go b/leetcode/1300.Sum-of-Mutated-Array-Closest-to-Target/1300. Sum of Mutated Array Closest to Target_test.go index 71337a7c..9fca7e54 100644 --- a/leetcode/1300.Sum-of-Mutated-Array-Closest-to-Target/1300. Sum of Mutated Array Closest to Target_test.go +++ b/leetcode/1300.Sum-of-Mutated-Array-Closest-to-Target/1300. Sum of Mutated Array Closest to Target_test.go @@ -27,17 +27,17 @@ func Test_Problem1300(t *testing.T) { qs := []question1300{ - question1300{ + { para1300{[]int{4, 9, 3}, 10}, ans1300{3}, }, - question1300{ + { para1300{[]int{2, 3, 5}, 10}, ans1300{5}, }, - question1300{ + { para1300{[]int{60864, 25176, 27249, 21296, 20204}, 56803}, ans1300{11361}, }, diff --git a/leetcode/1302.Deepest-Leaves-Sum/1302. Deepest Leaves Sum_test.go b/leetcode/1302.Deepest-Leaves-Sum/1302. Deepest Leaves Sum_test.go index 94459050..b968b98e 100644 --- a/leetcode/1302.Deepest-Leaves-Sum/1302. Deepest Leaves Sum_test.go +++ b/leetcode/1302.Deepest-Leaves-Sum/1302. Deepest Leaves Sum_test.go @@ -28,12 +28,12 @@ func Test_Problem1302(t *testing.T) { qs := []question1302{ - question1302{ + { para1302{[]int{1, 2, 3, 4, 5, structures.NULL, 6, 7, structures.NULL, structures.NULL, structures.NULL, structures.NULL, 8}}, ans1302{15}, }, - question1302{ + { para1302{[]int{}}, ans1302{0}, }, diff --git a/leetcode/1304.Find-N-Unique-Integers-Sum-up-to-Zero/1304. Find N Unique Integers Sum up to Zero_test.go b/leetcode/1304.Find-N-Unique-Integers-Sum-up-to-Zero/1304. Find N Unique Integers Sum up to Zero_test.go index ab6131c5..91874da5 100644 --- a/leetcode/1304.Find-N-Unique-Integers-Sum-up-to-Zero/1304. Find N Unique Integers Sum up to Zero_test.go +++ b/leetcode/1304.Find-N-Unique-Integers-Sum-up-to-Zero/1304. Find N Unique Integers Sum up to Zero_test.go @@ -26,22 +26,22 @@ func Test_Problem1304(t *testing.T) { qs := []question1304{ - question1304{ + { para1304{5}, ans1304{[]int{-7, -1, 1, 3, 4}}, }, - question1304{ + { para1304{0}, ans1304{[]int{}}, }, - question1304{ + { para1304{3}, ans1304{[]int{-1, 0, 1}}, }, - question1304{ + { para1304{1}, ans1304{[]int{0}}, }, diff --git a/leetcode/1305.All-Elements-in-Two-Binary-Search-Trees/1305. All Elements in Two Binary Search Trees_test.go b/leetcode/1305.All-Elements-in-Two-Binary-Search-Trees/1305. All Elements in Two Binary Search Trees_test.go index 2c2278bb..979acc63 100644 --- a/leetcode/1305.All-Elements-in-Two-Binary-Search-Trees/1305. All Elements in Two Binary Search Trees_test.go +++ b/leetcode/1305.All-Elements-in-Two-Binary-Search-Trees/1305. All Elements in Two Binary Search Trees_test.go @@ -29,27 +29,27 @@ func Test_Problem1305(t *testing.T) { qs := []question1305{ - question1305{ + { para1305{[]int{2, 1, 4}, []int{1, 0, 3}}, ans1305{[]int{0, 1, 1, 2, 3, 4}}, }, - question1305{ + { para1305{[]int{0, -10, 10}, []int{5, 1, 7, 0, 2}}, ans1305{[]int{-10, 0, 0, 1, 2, 5, 7, 10}}, }, - question1305{ + { para1305{[]int{}, []int{5, 1, 7, 0, 2}}, ans1305{[]int{0, 1, 2, 5, 7}}, }, - question1305{ + { para1305{[]int{0, -10, 10}, []int{}}, ans1305{[]int{-10, 0, 10}}, }, - question1305{ + { para1305{[]int{1, structures.NULL, 8}, []int{8, 1}}, ans1305{[]int{1, 1, 8, 8}}, }, diff --git a/leetcode/1306.Jump-Game-III/1306. Jump Game III_test.go b/leetcode/1306.Jump-Game-III/1306. Jump Game III_test.go index 886b81e9..1298ad75 100644 --- a/leetcode/1306.Jump-Game-III/1306. Jump Game III_test.go +++ b/leetcode/1306.Jump-Game-III/1306. Jump Game III_test.go @@ -27,17 +27,17 @@ func Test_Problem1306(t *testing.T) { qs := []question1306{ - question1306{ + { para1306{[]int{4, 2, 3, 0, 3, 1, 2}, 5}, ans1306{true}, }, - question1306{ + { para1306{[]int{4, 2, 3, 0, 3, 1, 2}, 0}, ans1306{true}, }, - question1306{ + { para1306{[]int{3, 0, 2, 1, 2}, 2}, ans1306{false}, }, diff --git a/leetcode/1313.Decompress-Run-Length-Encoded-List/1313. Decompress Run-Length Encoded List_test.go b/leetcode/1313.Decompress-Run-Length-Encoded-List/1313. Decompress Run-Length Encoded List_test.go index 18608311..ce5cad62 100644 --- a/leetcode/1313.Decompress-Run-Length-Encoded-List/1313. Decompress Run-Length Encoded List_test.go +++ b/leetcode/1313.Decompress-Run-Length-Encoded-List/1313. Decompress Run-Length Encoded List_test.go @@ -26,17 +26,17 @@ func Test_Problem1313(t *testing.T) { qs := []question1313{ - question1313{ + { para1313{[]int{1, 2, 3, 4}}, ans1313{[]int{2, 4, 4, 4}}, }, - question1313{ + { para1313{[]int{1, 1, 2, 3}}, ans1313{[]int{1, 3, 3}}, }, - question1313{ + { para1313{[]int{}}, ans1313{[]int{}}, }, diff --git a/leetcode/1317.Convert-Integer-to-the-Sum-of-Two-No-Zero-Integers/1317. Convert Integer to the Sum of Two No-Zero Integers_test.go b/leetcode/1317.Convert-Integer-to-the-Sum-of-Two-No-Zero-Integers/1317. Convert Integer to the Sum of Two No-Zero Integers_test.go index a4283613..b39cf2ff 100644 --- a/leetcode/1317.Convert-Integer-to-the-Sum-of-Two-No-Zero-Integers/1317. Convert Integer to the Sum of Two No-Zero Integers_test.go +++ b/leetcode/1317.Convert-Integer-to-the-Sum-of-Two-No-Zero-Integers/1317. Convert Integer to the Sum of Two No-Zero Integers_test.go @@ -26,47 +26,47 @@ func Test_Problem1317(t *testing.T) { qs := []question1317{ - question1317{ + { para1317{5}, ans1317{[]int{1, 4}}, }, - question1317{ + { para1317{0}, ans1317{[]int{}}, }, - question1317{ + { para1317{3}, ans1317{[]int{1, 2}}, }, - question1317{ + { para1317{1}, ans1317{[]int{}}, }, - question1317{ + { para1317{2}, ans1317{[]int{1, 1}}, }, - question1317{ + { para1317{11}, ans1317{[]int{2, 9}}, }, - question1317{ + { para1317{10000}, ans1317{[]int{1, 9999}}, }, - question1317{ + { para1317{69}, ans1317{[]int{1, 68}}, }, - question1317{ + { para1317{1010}, ans1317{[]int{11, 999}}, }, diff --git a/leetcode/1380.Lucky-Numbers-in-a-Matrix/1380. Lucky Numbers in a Matrix_test.go b/leetcode/1380.Lucky-Numbers-in-a-Matrix/1380. Lucky Numbers in a Matrix_test.go index 63ff58ea..73d9f314 100644 --- a/leetcode/1380.Lucky-Numbers-in-a-Matrix/1380. Lucky Numbers in a Matrix_test.go +++ b/leetcode/1380.Lucky-Numbers-in-a-Matrix/1380. Lucky Numbers in a Matrix_test.go @@ -26,23 +26,23 @@ func Test_Problem1380(t *testing.T) { qs := []question1380{ - question1380{ - para1380{[][]int{[]int{3, 7, 8}, []int{9, 11, 13}, []int{15, 16, 17}}}, + { + para1380{[][]int{{3, 7, 8}, {9, 11, 13}, {15, 16, 17}}}, ans1380{[]int{15}}, }, - question1380{ - para1380{[][]int{[]int{1, 10, 4, 2}, []int{9, 3, 8, 7}, []int{15, 16, 17, 12}}}, + { + para1380{[][]int{{1, 10, 4, 2}, {9, 3, 8, 7}, {15, 16, 17, 12}}}, ans1380{[]int{12}}, }, - question1380{ - para1380{[][]int{[]int{1, 2, 3, 4, 5}, []int{1, 2, 3, 4, 5}}}, + { + para1380{[][]int{{1, 2, 3, 4, 5}, {1, 2, 3, 4, 5}}}, ans1380{[]int{1}}, }, - question1380{ - para1380{[][]int{[]int{7, 8}, []int{1, 2}}}, + { + para1380{[][]int{{7, 8}, {1, 2}}}, ans1380{[]int{7}}, }, // 如需多个测试，可以复制上方元素。 diff --git a/leetcode/1385.Find-the-Distance-Value-Between-Two-Arrays/1385. Find the Distance Value Between Two Arrays_test.go b/leetcode/1385.Find-the-Distance-Value-Between-Two-Arrays/1385. Find the Distance Value Between Two Arrays_test.go index cbdfd0b5..070bf12a 100644 --- a/leetcode/1385.Find-the-Distance-Value-Between-Two-Arrays/1385. Find the Distance Value Between Two Arrays_test.go +++ b/leetcode/1385.Find-the-Distance-Value-Between-Two-Arrays/1385. Find the Distance Value Between Two Arrays_test.go @@ -28,17 +28,17 @@ func Test_Problem1385(t *testing.T) { qs := []question1385{ - question1385{ + { para1385{[]int{4, 5, 8}, []int{10, 9, 1, 8}, 2}, ans1385{[]int{2}}, }, - question1385{ + { para1385{[]int{1, 4, 2, 3}, []int{-4, -3, 6, 10, 20, 30}, 3}, ans1385{[]int{2}}, }, - question1385{ + { para1385{[]int{2, 1, 100, 3}, []int{-5, -2, 10, -3, 7}, 6}, ans1385{[]int{1}}, }, diff --git a/leetcode/1389.Create-Target-Array-in-the-Given-Order/1389. Create Target Array in the Given Order_test.go b/leetcode/1389.Create-Target-Array-in-the-Given-Order/1389. Create Target Array in the Given Order_test.go index 3eb5ee1f..779d36df 100644 --- a/leetcode/1389.Create-Target-Array-in-the-Given-Order/1389. Create Target Array in the Given Order_test.go +++ b/leetcode/1389.Create-Target-Array-in-the-Given-Order/1389. Create Target Array in the Given Order_test.go @@ -27,17 +27,17 @@ func Test_Problem1389(t *testing.T) { qs := []question1389{ - question1389{ + { para1389{[]int{0, 1, 2, 3, 4}, []int{0, 1, 2, 2, 1}}, ans1389{[]int{0, 4, 1, 3, 2}}, }, - question1389{ + { para1389{[]int{1, 2, 3, 4, 0}, []int{0, 1, 2, 3, 0}}, ans1389{[]int{0, 1, 2, 3, 4}}, }, - question1389{ + { para1389{[]int{1}, []int{0}}, ans1389{[]int{1}}, }, diff --git a/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence_test.go b/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence_test.go index 22607f7c..315483bd 100644 --- a/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence_test.go +++ b/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence_test.go @@ -27,27 +27,27 @@ func Test_Problem1455(t *testing.T) { qs := []question1455{ - question1455{ + { para1455{"i love eating burger", "burg"}, ans1455{4}, }, - question1455{ + { para1455{"this problem is an easy problem", "pro"}, ans1455{2}, }, - question1455{ + { para1455{"i am tired", "you"}, ans1455{-1}, }, - question1455{ + { para1455{"i use triple pillow", "pill"}, ans1455{4}, }, - question1455{ + { para1455{"hello from the other side", "they"}, ans1455{-1}, }, diff --git a/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array_test.go b/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array_test.go index 06c9821f..93b56c8b 100644 --- a/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array_test.go +++ b/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array_test.go @@ -26,22 +26,22 @@ func Test_Problem1464(t *testing.T) { qs := []question1464{ - question1464{ + { para1464{[]int{3, 4, 5, 2}}, ans1464{12}, }, - question1464{ + { para1464{[]int{1, 5, 4, 5}}, ans1464{16}, }, - question1464{ + { para1464{[]int{3, 7}}, ans1464{12}, }, - question1464{ + { para1464{[]int{1}}, ans1464{0}, }, diff --git a/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array_test.go b/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array_test.go index 212ecef9..e273744e 100644 --- a/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array_test.go +++ b/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array_test.go @@ -27,17 +27,17 @@ func Test_Problem1470(t *testing.T) { qs := []question1470{ - question1470{ + { para1470{[]int{2, 5, 1, 3, 4, 7}, 3}, ans1470{[]int{2, 3, 5, 4, 1, 7}}, }, - question1470{ + { para1470{[]int{1, 2, 3, 4, 4, 3, 2, 1}, 4}, ans1470{[]int{1, 4, 2, 3, 3, 2, 4, 1}}, }, - question1470{ + { para1470{[]int{1, 1, 2, 2}, 2}, ans1470{[]int{1, 2, 1, 2}}, }, diff --git a/leetcode/9990085.Maximal-Rectangle/85. Maximal Rectangle_test.go b/leetcode/9990085.Maximal-Rectangle/85. Maximal Rectangle_test.go index 12853fbf..d4dd5a4c 100644 --- a/leetcode/9990085.Maximal-Rectangle/85. Maximal Rectangle_test.go +++ b/leetcode/9990085.Maximal-Rectangle/85. Maximal Rectangle_test.go @@ -26,8 +26,8 @@ func Test_Problem85(t *testing.T) { qs := []question85{ - question85{ - para85{[][]byte{[]byte{'1', '0', '1', '0', '0'}, []byte{'1', '0', '1', '1', '1'}, []byte{'1', '1', '1', '1', '1'}, []byte{'1', '0', '0', '1', '0'}}}, + { + para85{[][]byte{{'1', '0', '1', '0', '0'}, {'1', '0', '1', '1', '1'}, {'1', '1', '1', '1', '1'}, {'1', '0', '0', '1', '0'}}}, ans85{6}, }, } diff --git a/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go b/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go index 1588e30a..b7acf949 100644 --- a/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go +++ b/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go @@ -26,7 +26,7 @@ func Test_Problem132(t *testing.T) { qs := []question132{ - question132{ + { para132{"aab"}, ans132{1}, }, diff --git a/leetcode/9990316.Remove-Duplicate-Letters/316. Remove Duplicate Letters_test.go b/leetcode/9990316.Remove-Duplicate-Letters/316. Remove Duplicate Letters_test.go index 9768dbb3..8ec7713a 100644 --- a/leetcode/9990316.Remove-Duplicate-Letters/316. Remove Duplicate Letters_test.go +++ b/leetcode/9990316.Remove-Duplicate-Letters/316. Remove Duplicate Letters_test.go @@ -26,11 +26,11 @@ func Test_Problem316(t *testing.T) { qs := []question316{ - question316{ + { para316{"bcabc"}, ans316{"abc"}, }, - question316{ + { para316{"cbacdcbc"}, ans316{"acdb"}, }, diff --git a/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go b/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go index 58b045b5..eab0e5b6 100644 --- a/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go +++ b/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go @@ -21,7 +21,7 @@ func Constructor352() SummaryRanges { func (sr *SummaryRanges) AddNum(val int) { if sr.intervals == nil { sr.intervals = []Interval{ - Interval{ + { Start: val, End: val, }, diff --git a/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K_test.go b/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K_test.go index 09cfe875..9c62eb0f 100644 --- a/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K_test.go +++ b/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K_test.go @@ -27,23 +27,23 @@ func Test_Problem363(t *testing.T) { qs := []question363{ - question363{ - para363{[][]int{[]int{1, 0, 1}, []int{0, -2, 3}}, 2}, + { + para363{[][]int{{1, 0, 1}, {0, -2, 3}}, 2}, ans363{2}, }, - question363{ - para363{[][]int{[]int{2, 2, -1}}, 0}, + { + para363{[][]int{{2, 2, -1}}, 0}, ans363{-1}, }, - question363{ - para363{[][]int{[]int{5, -4, -3, 4}, []int{-3, -4, 4, 5}, []int{5, 1, 5, -4}}, 8}, + { + para363{[][]int{{5, -4, -3, 4}, {-3, -4, 4, 5}, {5, 1, 5, -4}}, 8}, ans363{8}, }, - question363{ - para363{[][]int{[]int{5, -4, -3, 4}, []int{-3, -4, 4, 5}, []int{5, 1, 5, -4}}, 3}, + { + para363{[][]int{{5, -4, -3, 4}, {-3, -4, 4, 5}, {5, 1, 5, -4}}, 3}, ans363{2}, }, } diff --git a/leetcode/9990377.Combination-Sum-IV/377. Combination Sum IV_test.go b/leetcode/9990377.Combination-Sum-IV/377. Combination Sum IV_test.go index 56de0654..de17f246 100644 --- a/leetcode/9990377.Combination-Sum-IV/377. Combination Sum IV_test.go +++ b/leetcode/9990377.Combination-Sum-IV/377. Combination Sum IV_test.go @@ -27,12 +27,12 @@ func Test_Problem377(t *testing.T) { qs := []question377{ - question377{ + { para377{[]int{1, 2, 3}, 4}, ans377{7}, }, - question377{ + { para377{[]int{1, 2, 3}, 32}, ans377{7}, }, diff --git a/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go b/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go index 05c97087..0d3306d1 100644 --- a/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go +++ b/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go @@ -5,7 +5,7 @@ import ( ) func oddEvenJumps(A []int) int { - oddJumpMap, evenJumpMap, count, current, res := map[int]int{}, map[int]int{}, 1, 0, 0 + oddJumpMap, evenJumpMap, current, res := map[int]int{}, map[int]int{}, 0, 0 for i := 0; i < len(A); i++ { for j := i + 1; j < len(A); j++ { if v, ok := oddJumpMap[i]; ok { @@ -42,7 +42,8 @@ func oddEvenJumps(A []int) int { } fmt.Printf("oddJumpMap = %v evenJumpMap = %v\n", oddJumpMap, evenJumpMap) for i := 0; i < len(A); i++ { - count, current = 1, i + count := 1 + current = i for { if count%2 == 1 { if v, ok := oddJumpMap[current]; ok { diff --git a/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump_test.go b/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump_test.go index c8565314..899c73c7 100644 --- a/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump_test.go +++ b/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump_test.go @@ -26,17 +26,17 @@ func Test_Problem975(t *testing.T) { qs := []question975{ - question975{ + { para975{[]int{10, 13, 12, 14, 15}}, ans975{2}, }, - question975{ + { para975{[]int{2, 3, 1, 1, 4}}, ans975{3}, }, - question975{ + { para975{[]int{5, 1, 3, 4, 2}}, ans975{3}, }, diff --git a/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring_test.go b/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring_test.go index 15b19927..e09ceac6 100644 --- a/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring_test.go +++ b/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring_test.go @@ -25,12 +25,12 @@ type ans1044 struct { func Test_Problem1044(t *testing.T) { qs := []question1044{ - question1044{ + { para1044{"banana"}, ans1044{"ana"}, }, - question1044{ + { para1044{"abcd"}, ans1044{""}, }, diff --git a/leetcode/9991292.Maximum-Side-Length-of-a-Square-with-Sum-Less-than-or-Equal-to-Threshold/1292. Maximum Side Length of a Square with Sum Less than or Equal to Threshold_test.go b/leetcode/9991292.Maximum-Side-Length-of-a-Square-with-Sum-Less-than-or-Equal-to-Threshold/1292. Maximum Side Length of a Square with Sum Less than or Equal to Threshold_test.go index d731d517..0c713cd1 100644 --- a/leetcode/9991292.Maximum-Side-Length-of-a-Square-with-Sum-Less-than-or-Equal-to-Threshold/1292. Maximum Side Length of a Square with Sum Less than or Equal to Threshold_test.go +++ b/leetcode/9991292.Maximum-Side-Length-of-a-Square-with-Sum-Less-than-or-Equal-to-Threshold/1292. Maximum Side Length of a Square with Sum Less than or Equal to Threshold_test.go @@ -27,13 +27,13 @@ func Test_Problem1292(t *testing.T) { qs := []question1292{ - question1292{ - para1292{[][]int{[]int{1, 1, 3, 2, 4, 3, 2}, []int{1, 1, 3, 2, 4, 3, 2}, []int{1, 1, 3, 2, 4, 3, 2}}, 4}, + { + para1292{[][]int{{1, 1, 3, 2, 4, 3, 2}, {1, 1, 3, 2, 4, 3, 2}, {1, 1, 3, 2, 4, 3, 2}}, 4}, ans1292{2}, }, - question1292{ - para1292{[][]int{[]int{2, 2, 2, 2, 2}, []int{2, 2, 2, 2, 2}, []int{2, 2, 2, 2, 2}, []int{2, 2, 2, 2, 2}, []int{2, 2, 2, 2, 2}}, 1}, + { + para1292{[][]int{{2, 2, 2, 2, 2}, {2, 2, 2, 2, 2}, {2, 2, 2, 2, 2}, {2, 2, 2, 2, 2}, {2, 2, 2, 2, 2}}, 1}, ans1292{0}, }, } diff --git a/structures/Interval.go b/structures/Interval.go index 77715216..bed1432e 100644 --- a/structures/Interval.go +++ b/structures/Interval.go @@ -50,4 +50,4 @@ func partitionSort(a []Interval, lo, hi int) int { } a[i+1], a[hi] = a[hi], a[i+1] return i + 1 -} \ No newline at end of file +} diff --git a/structures/Interval_test.go b/structures/Interval_test.go index aeb83704..dd36e40a 100644 --- a/structures/Interval_test.go +++ b/structures/Interval_test.go @@ -19,19 +19,19 @@ func Test_IntervalSlice2Intss(t *testing.T) { actual := IntervalSlice2Intss( []Interval{ - Interval{ + { Start: 1, End: 2, }, - Interval{ + { Start: 3, End: 4, }, }, ) expected := [][]int{ - []int{1, 2}, - []int{3, 4}, + {1, 2}, + {3, 4}, } ast.Equal(expected, actual) @@ -40,18 +40,18 @@ func Test_Intss2IntervalSlice(t *testing.T) { ast := assert.New(t) expected := []Interval{ - Interval{ + { Start: 1, End: 2, }, - Interval{ + { Start: 3, End: 4, }, } actual := Intss2IntervalSlice([][]int{ - []int{1, 2}, - []int{3, 4}, + {1, 2}, + {3, 4}, }, ) diff --git a/structures/Point_test.go b/structures/Point_test.go index 9282179e..48b6dc1c 100644 --- a/structures/Point_test.go +++ b/structures/Point_test.go @@ -26,11 +26,11 @@ func Test_Intss2Points(t *testing.T) { }, }, []Point{ - Point{X: 1, Y: 0}, - Point{X: 2, Y: 0}, - Point{X: 3, Y: 0}, - Point{X: 4, Y: 0}, - Point{X: 5, Y: 0}, + {X: 1, Y: 0}, + {X: 2, Y: 0}, + {X: 3, Y: 0}, + {X: 4, Y: 0}, + {X: 5, Y: 0}, }, }, } @@ -54,11 +54,11 @@ func Test_Points2Intss(t *testing.T) { "测试 [][]int 转换成 []Point ", args{ []Point{ - Point{X: 1, Y: 0}, - Point{X: 2, Y: 0}, - Point{X: 3, Y: 0}, - Point{X: 4, Y: 0}, - Point{X: 5, Y: 0}, + {X: 1, Y: 0}, + {X: 2, Y: 0}, + {X: 3, Y: 0}, + {X: 4, Y: 0}, + {X: 5, Y: 0}, }, }, [][]int{ diff --git a/website/content/ChapterFour/0080.Remove-Duplicates-from-Sorted-Array-II.md b/website/content/ChapterFour/0080.Remove-Duplicates-from-Sorted-Array-II.md index 196dd6a5..e0811e92 100644 --- a/website/content/ChapterFour/0080.Remove-Duplicates-from-Sorted-Array-II.md +++ b/website/content/ChapterFour/0080.Remove-Duplicates-from-Sorted-Array-II.md @@ -71,9 +71,9 @@ func removeDuplicates80(nums []int) int { if len(nums) == 0 { return 0 } - last, finder, startFinder := 0, 0, -1 + last, finder := 0, 0 for last < len(nums)-1 { - startFinder = -1 + startFinder := -1 for nums[finder] == nums[last] { if startFinder == -1 || startFinder > finder { startFinder = finder @@ -101,4 +101,5 @@ func removeDuplicates80(nums []int) int { return last + 1 } + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0095.Unique-Binary-Search-Trees-II.md b/website/content/ChapterFour/0095.Unique-Binary-Search-Trees-II.md index 20386399..790470c1 100755 --- a/website/content/ChapterFour/0095.Unique-Binary-Search-Trees-II.md +++ b/website/content/ChapterFour/0095.Unique-Binary-Search-Trees-II.md @@ -62,10 +62,9 @@ func generateBSTree(start, end int) []*TreeNode { tree = append(tree, nil) return tree } - left, right := []*TreeNode{}, []*TreeNode{} for i := start; i <= end; i++ { - left = generateBSTree(start, i-1) - right = generateBSTree(i+1, end) + left := generateBSTree(start, i-1) + right := generateBSTree(i+1, end) for _, l := range left { for _, r := range right { root := &TreeNode{Val: i, Left: l, Right: r} diff --git a/website/content/ChapterFour/0147.Insertion-Sort-List.md b/website/content/ChapterFour/0147.Insertion-Sort-List.md index 7b60283b..80bedc45 100644 --- a/website/content/ChapterFour/0147.Insertion-Sort-List.md +++ b/website/content/ChapterFour/0147.Insertion-Sort-List.md @@ -60,11 +60,9 @@ func insertionSortList(head *ListNode) *ListNode { return head } newHead := &ListNode{Val: 0, Next: nil} // 这里初始化不要直接指向 head，为了下面循环可以统一处理 - cur := head - pre := newHead - next := &ListNode{Val: 0, Next: nil} + cur, pre := head, newHead for cur != nil { - next = cur.Next + next := cur.Next for pre.Next != nil && pre.Next.Val < cur.Val { pre = pre.Next } diff --git a/website/content/ChapterFour/0224.Basic-Calculator.md b/website/content/ChapterFour/0224.Basic-Calculator.md index 041f8382..5861726a 100755 --- a/website/content/ChapterFour/0224.Basic-Calculator.md +++ b/website/content/ChapterFour/0224.Basic-Calculator.md @@ -97,7 +97,7 @@ func calculate1(s string) int { break } } - tmp = string(stack[index+1 : len(stack)]) + tmp = string(stack[index+1:]) stack = stack[:index] res := strconv.Itoa(calculateStr(tmp)) for j := 0; j < len(res); j++ { @@ -142,7 +142,6 @@ func calculateStr(str string) int { if tmpStr != "" { num, _ := strconv.Atoi(tmpStr) nums = append(nums, num) - tmpStr = "" } res = nums[0] for i := 0; i < len(s); i++ { @@ -156,4 +155,11 @@ func calculateStr(str string) int { return res } +func isDigital(v byte) bool { + if v >= '0' && v <= '9' { + return true + } + return false +} + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0392.Is-Subsequence.md b/website/content/ChapterFour/0392.Is-Subsequence.md index 06b92fe7..09ff2c75 100755 --- a/website/content/ChapterFour/0392.Is-Subsequence.md +++ b/website/content/ChapterFour/0392.Is-Subsequence.md @@ -46,9 +46,9 @@ package leetcode // 解法一 O(n^2) func isSubsequence(s string, t string) bool { - index, flag := 0, false + index := 0 for i := 0; i < len(s); i++ { - flag = false + flag := false for ; index < len(t); index++ { if s[i] == t[index] { flag = true @@ -76,4 +76,5 @@ func isSubsequence1(s string, t string) bool { return len(s) == 0 } + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0424.Longest-Repeating-Character-Replacement.md b/website/content/ChapterFour/0424.Longest-Repeating-Character-Replacement.md index 2c0681db..8e54fbcc 100644 --- a/website/content/ChapterFour/0424.Longest-Repeating-Character-Replacement.md +++ b/website/content/ChapterFour/0424.Longest-Repeating-Character-Replacement.md @@ -62,8 +62,8 @@ The substring "BBBB" has the longest repeating letters, which is 4. package leetcode func characterReplacement(s string, k int) int { - res, left, right, counter, freq := 0, 0, 1, 0, make([]int, 26) - for right = 0; right < len(s); right++ { + res, left, counter, freq := 0, 0, 0, make([]int, 26) + for right := 0; right < len(s); right++ { freq[s[right]-'A']++ counter = max(counter, freq[s[right]-'A']) for right-left+1-counter > k { @@ -75,4 +75,11 @@ func characterReplacement(s string, k int) int { return res } +func max(a int, b int) int { + if a > b { + return a + } + return b +} + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0496.Next-Greater-Element-I.md b/website/content/ChapterFour/0496.Next-Greater-Element-I.md index 7c2aafb4..2a62ef32 100644 --- a/website/content/ChapterFour/0496.Next-Greater-Element-I.md +++ b/website/content/ChapterFour/0496.Next-Greater-Element-I.md @@ -57,12 +57,12 @@ func nextGreaterElement(nums1 []int, nums2 []int) []int { if len(nums1) == 0 || len(nums2) == 0 { return []int{} } - res, reocrd, flag := []int{}, map[int]int{}, false + res, reocrd := []int{}, map[int]int{} for i, v := range nums2 { reocrd[v] = i } for i := 0; i < len(nums1); i++ { - flag = false + flag := false for j := reocrd[nums1[i]]; j < len(nums2); j++ { if nums2[j] > nums1[i] { res = append(res, nums2[j]) diff --git a/website/content/ChapterFour/0725.Split-Linked-List-in-Parts.md b/website/content/ChapterFour/0725.Split-Linked-List-in-Parts.md index 7a737553..6c7fdf87 100644 --- a/website/content/ChapterFour/0725.Split-Linked-List-in-Parts.md +++ b/website/content/ChapterFour/0725.Split-Linked-List-in-Parts.md @@ -87,9 +87,8 @@ func splitListToParts(root *ListNode, k int) []*ListNode { length := getLength(root) splitNum := length / k lengNum := length % k - cur := root - head := root - pre := root + cur, head := root, root + var pre *ListNode fmt.Printf("总长度 %v, 分 %v 组, 前面 %v 组长度为 %v, 剩余 %v 组，每组 %v\n", length, k, lengNum, splitNum+1, k-lengNum, splitNum) if splitNum == 0 { for i := 0; i < k; i++ { @@ -130,4 +129,14 @@ func splitListToParts(root *ListNode, k int) []*ListNode { return res } +func getLength(l *ListNode) int { + count := 0 + cur := l + for cur != nil { + count++ + cur = cur.Next + } + return count +} + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0828.COPYRIGHT-PROBLEM-XXX.md b/website/content/ChapterFour/0828.COPYRIGHT-PROBLEM-XXX.md index e75636fe..49ebc4c0 100644 --- a/website/content/ChapterFour/0828.COPYRIGHT-PROBLEM-XXX.md +++ b/website/content/ChapterFour/0828.COPYRIGHT-PROBLEM-XXX.md @@ -55,10 +55,9 @@ func uniqueLetterString1(S string) int { if len(S) == 0 { return 0 } - letterMap := map[byte]int{} res, mod := 0, 1000000007 for i := 0; i < len(S); i++ { - letterMap = map[byte]int{} + letterMap := map[byte]int{} for j := i; j < len(S); j++ { letterMap[S[j]]++ tmp := 0 @@ -77,4 +76,5 @@ func uniqueLetterString1(S string) int { return res % mod } + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0897.Increasing-Order-Search-Tree.md b/website/content/ChapterFour/0897.Increasing-Order-Search-Tree.md index 4c1946f3..44076d30 100755 --- a/website/content/ChapterFour/0897.Increasing-Order-Search-Tree.md +++ b/website/content/ChapterFour/0897.Increasing-Order-Search-Tree.md @@ -97,12 +97,12 @@ func recBST(root, tail *TreeNode) *TreeNode { // 解法二 模拟 func increasingBST1(root *TreeNode) *TreeNode { - list, newRoot := []int{}, &TreeNode{} + list := []int{} inorder(root, &list) if len(list) == 0 { return root } - newRoot = &TreeNode{Val: list[0], Left: nil, Right: nil} + newRoot := &TreeNode{Val: list[0], Left: nil, Right: nil} cur := newRoot for index := 1; index < len(list); index++ { tmp := &TreeNode{Val: list[index], Left: nil, Right: nil} @@ -112,4 +112,12 @@ func increasingBST1(root *TreeNode) *TreeNode { return newRoot } +func inorder(root *TreeNode, output *[]int) { + if root != nil { + inorder(root.Left, output) + *output = append(*output, root.Val) + inorder(root.Right, output) + } +} + ``` \ No newline at end of file diff --git a/website/content/ChapterFour/0980.Unique-Paths-III.md b/website/content/ChapterFour/0980.Unique-Paths-III.md index 5e0c30ee..94f53c18 100755 --- a/website/content/ChapterFour/0980.Unique-Paths-III.md +++ b/website/content/ChapterFour/0980.Unique-Paths-III.md @@ -69,6 +69,13 @@ Return the number of 4-directional walks from the starting square to the ending package leetcode +var dir = [][]int{ + {-1, 0}, + {0, 1}, + {1, 0}, + {0, -1}, +} + func uniquePathsIII(grid [][]int) int { visited := make([][]bool, len(grid)) for i := 0; i < len(visited); i++ { @@ -115,7 +122,7 @@ func findUniquePathIII(board [][]int, visited [][]bool, path []int, empty, start } } visited[startx][starty] = false - empty++ + //empty++ 这里虽然可以还原这个变量值，但是赋值没有意义，干脆不写了 path = path[:len(path)-2] } return